From gene to protein DNA mRNA protein trait nucleus cytoplasm

Slides:



Advertisements
Similar presentations
From Gene to Protein How Genes Work
Advertisements

Protein Synthesis Making Proteins
Regents Biology Protein Synthesis Making Proteins.
DNA gets all the glory, but proteins do all the work!
Protein Synthesis Notes
AP Biology From Gene to Protein How Genes Work.
Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.
AP Biology From Gene to Protein How Genes Work.
Protein Synthesis Making Proteins
AP Biology Lecture #33 Translation.
Protein Synthesis Translation. DNA (genes) information copied to make  mRNA (transcription) Information in mRNA sequence used to put together  Chain.
From Gene to Protein How Genes Work
AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?
Protein Synthesis. Transcription DNA  mRNA Occurs in the nucleus Translation mRNA  tRNA  AA Occurs at the ribosome.
Relate the concept of the gene to the sequence of nucleotides in DNA.
RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.
AP Details for Protein Synthesis 2014 From gene to protein.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
Chapter 8: From DNA to Protein Section Transcription
Protein Synthesis.
Regents Biology From gene to protein: transcription translation protein.
Protein Synthesis Making Proteins
From Gene to Protein proteinscellsbodies How does DNA code for cells & bodies? DNA.
D.N.A 1. The information carried by a DNA molecule is in
Protein Synthesis. One Gene – One Enzyme Protein Synthesis.
Protein Synthesis Making Proteins DNAmRNA tRNA Protein.
AP Biology Chapter 17. From Gene to Protein.
Protein Synthesis- Translation
Protein Synthesis Translation.
Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus
From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
from nucleic acid language to amino acid language
Chapter 17: From Gene to Protein
From Gene to Protein How Genes Work (Ch. 17).
Protein Synthesis Making Proteins
Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.
Transcription and Translation Video Notes
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work.
Translation Unit 5B.4.
From Gene to Protein How Genes Work
Ch 17 - From Gene to Protein
From Gene to Protein How Genes Work
Protein Synthesis Ch 17.
Protein Synthesis.
Protein Synthesis.
From Gene to Protein.
From Gene to Protein How Genes Work
From Gene to Protein Chapter 17.
From Gene to Protein Chapter 17 - Campbell.
Protein Synthesis Making Proteins
from nucleic acid language to amino acid language
From Gene to Protein How Genes Work
Protein Synthesis Using DNA to Make Proteins
Protein Synthesis Making Proteins
Protein Synthesis Making Proteins
Translation.
From Gene to Protein Chapter 17 - Campbell.
Protein Synthesis Making Proteins
Genetics: A whole new look at “who’s who.”
Protein Synthesis - Making Proteins
Enter Date Aim: Making Proteins Warm-up: HW:.
Big Q: What role does the ribosome play in assembling proteins?
Protein Synthesis Making Proteins
from nucleic acid language to amino acid language to PROTEIN language
From Gene to Protein Chapter 17 - Campbell.
Presentation transcript:

From gene to protein DNA mRNA protein trait nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

From gene to protein DNA mRNA protein trait nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

Can you tell the story? RNA polymerase DNA amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome