Download presentation
Presentation is loading. Please wait.
1
from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language
2
How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
3
? TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC
mRNA codes for proteins in triplets called codons: Each codon calls for 1 amino acid TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
4
The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
5
Wobble? What is wobble?
6
How are the codons matched to amino acids?
tRNA finds the correct amino acid that responds to the codon and brings it to the ribosome 3 5 DNA TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC 5 3 mRNA codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid
7
Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end
8
tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
9
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A
10
Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A
11
Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'
12
start of a secretory pathway
Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway
13
Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome
14
The Transcriptional unit (gene?)
enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start UTR introns transcription stop UTR promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA
15
Protein Synthesis in Prokaryotes
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall
16
Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
17
Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
18
Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing
19
What color would a smurf turn if he held his breath?
Any Questions?? What color would a smurf turn if he held his breath?
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.