Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genetics: A whole new look at “who’s who.”

Published byBenny Sudirman Modified over 5 years ago

Similar presentations

Presentation on theme: "Genetics: A whole new look at “who’s who.”"— Presentation transcript:

1 Genetics: A whole new look at “who’s who.”
Lesson 15: Protein Synthesis and Gene Regulation Genetics: A whole new look at “who’s who.”

2 Central Dogma From Gene to Protein

3 Bodies  Cells  DNA Bodies are made up of cells
All cells run on a set of instructions spelled out in DNA

4 Remember… A pairs with T A : T C pairs with G C : G
Bases match together A pairs with T A : T C pairs with G C : G weak bonds between bases join 2 strands can separate easily

5 What do we know? DNA Proteins
DNA is the genetic information Proteins proteins run living organisms enzymes all chemical reactions in living organisms are controlled by enzymes (proteins) structure all living organisms are built out of proteins DNA is the instructions for making proteins

6 What else do we know? DNA Proteins
DNA is in the nucleus want to keep it there = protected “locked in the vault” Proteins made by a “protein factory” in cytoplasm ribosomes Need to get gene (DNA) information from nucleus to cytoplasm need a messenger! need a copy of DNA mRNA nucleus

7 DNA RNA G, C, A, T T : A C : G G, C, A, U U : A C : G
deoxyribose sugar nitrogen bases G, C, A, T T = thymine T : A C : G double stranded ribose sugar nitrogen bases G, C, A, U U = uracil U : A C : G single stranded

8 From nucleus to cytoplasm
transcription DNA mRNA protein translation trait nucleus cytoplasm

9 The problem with DNA… TOO BIG!
DNA (double helix) is too big to go through the pores in the nuclear envelope. Just right. RNA (single helix) is small. DNA gives its information to mRNA (messenger RNA) to carry out of the nucleus.

10 DNA strand is the template (pattern)
TRANSCRIPTION Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase mRNA

11 Making mRNA from DNA TRANSCRIPTION T G G T A C A G C T A G T C A T C G
U U U U U T G G T A C A G C T A G T C A T C G T A C C G T

12 Double stranded DNA unzips
TRANSCRIPTION Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

13 Match free floating RNA bases to DNA bases on one of the DNA strands
TRANSCRIPTION A Use RNA polymerase Match free floating RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

14 U instead of T is matched to A
TRANSCRIPTION U instead of T is matched to A T A C G l I U DNA mRNA

15 What do we know NOW? DNA mRNA Proteins What reads RNA?
instructions remain in nucleus mRNA has the instructions for building proteins from DNA Proteins built as chains of amino acids What reads RNA? need a mRNA reader! ribosome U C A G aa Flash: Central Dogma Transcription

16 mRNA leaves nucleus through nuclear pores
From gene to protein CELL cytoplasm Protein Trait aa aa Transcription aa DNA aa Translation aa mRNA aa aa nucleus ribosome U C A G mRNA leaves nucleus through nuclear pores Ribosomes synthesize amino acids to make a protein using instructions on mRNA

17 What do we ALSO know now? mRNA Proteins What reads mRNA?
ribosome U C A G aa mRNA has the instructions for building proteins from DNA Proteins built as chains of amino acids What reads mRNA? ribosome What brings the right amino acid to attach to the protein chain? need an amino acid transporter!

18 From gene to protein Protein Trait DNA mRNA CELL cytoplasm
aa aa Transcription aa DNA aa Translation aa mRNA aa nucleus ribosome U C A G aa tRNA tRNA carries the correct amino acid (based on the mRNAcode) to the ribosome.

19 How does tRNA know which amino acid to bring?
When mRNA leaves nucleus it has a blueprint of DNA’s instructions. mRNA goes to ribosomes in cytoplasm Ribosomes read the blueprint on mRNA. mRNA ribosome A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa

20 TACGCACATTTACGTACGCGG
Using the blueprints… TACGCACATTTACGTACGCGG DNA mRNA AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala protein How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

21 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA Codon = set of 3 bases mRNA AUGCGUGUAAAUGCAUGCGCC ribosome AUGCGUGUAAAUGCAUGCGCC ? UAC Anticodon = set of 3 bases Met Arg Val Asn Ala Cys Ala Amino acid

22 The code is UNIVERSAL! AUG Since all living organisms…
use the same DNA use the same code book read their genes the same way

23 The mRNA code For ALL life! Code is redundant Start codon Stop codons
Uses only 4 bases for ALL life. (strongest support for a common origin for all life) Code is redundant several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

24 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC
mRNA DNA AUGCGUGUAAAUGCAUGCGCC tRNA Ser tRNA Met Pro Ala Met Leu Val

25 A different view of PROTEIN SYNTHESIS

26 DNA transcription mRNA ribosome translation
amino acids mRNA Can you tell the story? protein ribosome tRNA translation

27 Gene Regulation…Keeping Control!
Every species has its own number of chromosomes in each cell. Organism Number of Chromosomes Cat 32 Chimpanzee 48 Dog 78 Cow 60 Human 46 Horse 64 Pea plant 14 Corn plant 20 Mosquito 6 Honeybee Sugarcane 80 Sand dollar 62 Notice: More is not always better... Sometimes it’s just more.

28 Remember…a section on a chromosome that codes for a specific trait is called a GENE.
And… There are lots and lots of genes on each chromosome! The job of a gene is to control the production of proteins.

29 Not every gene is expressed at the same time.
Gene Regulation = what controls when a gene is turned on or turned off (expressed). In bacteria, genes are in groups called Operons. Example: E. coli that’s in our digestive system helps us break down milk. Each Operon codes for a specific protein.

30 Lac operon Has to have a CAP to start. Are You Lactose Intolerant?
Here’s how we metabolize milk… Can NOT have a Repressor. Lac operon

31 Some questions ask you to INFER the meaning of a term
Some questions ask you to INFER the meaning of a term. If you cannot recall its meaning try to figure out how the word is used outside of science. Example: Regulation TEST TIPS

Download ppt "Genetics: A whole new look at “who’s who.”"

Similar presentations

Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.

Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page.
Protein Synthesis Making Proteins

Protein Synthesis Making Proteins
What makes you look like your parents? Your parents passed down their DNA to you. What’s carried in your DNA that gives you your traits & characteristics?

What makes you look like your parents? Your parents passed down their DNA to you. What’s carried in your DNA that gives you your traits & characteristics?
DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.

DNA, RNA, and Protein Section Objectives: By the end of this section of notes your should be able to: Relate the concept of the gene to the sequence of.
Regents Biology 2009-2010 Protein Synthesis Making Proteins.

Regents Biology Protein Synthesis Making Proteins.
DNA AND PROTEIN SYNTHESIS 2008. DNA (DEOXYRIBONUCLEIC ACID) Nucleic acid that composes chromosomes and carries genetic information.

DNA AND PROTEIN SYNTHESIS DNA (DEOXYRIBONUCLEIC ACID) Nucleic acid that composes chromosomes and carries genetic information.
Transcription.

Transcription.
Goal 3.01b: Protein Synthesis and Gene Regulation.

Goal 3.01b: Protein Synthesis and Gene Regulation.
Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.

Protein Synthesis Making Proteins  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
Protein Synthesis Making Proteins

Protein Synthesis Making Proteins
GENE EXPRESSION TRANSCRIPTION, TRANSLATION AND MUTATIONS.

GENE EXPRESSION TRANSCRIPTION, TRANSLATION AND MUTATIONS.
RNA and Protein Synthesis

RNA and Protein Synthesis
Relate the concept of the gene to the sequence of nucleotides in DNA.

Relate the concept of the gene to the sequence of nucleotides in DNA.
RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.

RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins.
DNA to Protein Transcription & Translation.  What are these nucleotides telling us?  Sequence of nucleotides in DNA contains information to produce.

DNA to Protein Transcription & Translation.  What are these nucleotides telling us?  Sequence of nucleotides in DNA contains information to produce.
CH. 12.3 : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved.

CH : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved.
Chapter 8: From DNA to Protein Section Transcription

Chapter 8: From DNA to Protein Section Transcription
Structure of DNA DNA is made up of a long chain of nucleotides

Structure of DNA DNA is made up of a long chain of nucleotides
Protein Synthesis. RNA (RIBONUCLEIC ACID)  Nucleic acid involved in the synthesis of proteins  Subunits are nucleotides  Nucleotides are composed of.

Protein Synthesis. RNA (RIBONUCLEIC ACID)  Nucleic acid involved in the synthesis of proteins  Subunits are nucleotides  Nucleotides are composed of.

Similar presentations

Ads by Google