Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis Notes

Published byAshlie Cross Modified over 8 years ago

Similar presentations

Presentation on theme: "Protein Synthesis Notes"— Presentation transcript:

1 Protein Synthesis Notes
Ch 17

2 Central Dogma DNA RNA Protein

3 Prokaryotic vs Eukaryotic Transcription
Prokaryotic Transcription -takes place in cytoplasm -circular DNA w/no histones -no introns / no mRNA processing Eukaryotic Transcription -takes place in nucleus -DNA has histones and linear -introns and mRNA processing

4 Prokaryotic Transcription
STEPS Initiation – RNA polymerase binds to promoter Elongation – RNA polymerase reads template 3’-5’ and builds mRNA strand 5’-3’ Termination – mRNA is released … forms hairpin loop. Transcription begins when an RNA polymerase binds to a promoter site on the 5' to 3' DNA (blueprint) strand. A small polypeptide portion of the RNA polymerase molecule called the sigma factor recognizes the promotor site sequence. A short leader sequence of about 10 DNA nucleotides separates the promoter from the actual gene sequence.

5 Eukaryotic Transcription
Initiation – Transcription factors adhere to the TATA box in the promoter signaling RNA Polymerase II to attach. Additional transcription factors attach and the transcription initiation complex is formed. Enhancers/silencers Elongation – RNA Polymerase II unzips the DNA and pairs the template with complementary mRNA nucleotides. Termination – RNA Polymerase II reaches the polyadenylation (AAUAAA) sequence and releases the pre-mRNA. Regulatory sequences which increase the rate of transcription are called enhancers - those which decrease the rate of transcription are called silencers Enhancers can work if their position is moved to a new location (but still relatively near the gene - they won't work if they are millions of base pairs away or on a different chromosome) transcription *Gene expression is most often regulated at transcription

6 Eukaryotic Transcription
HHMI transcription initiation complex Eukaryotic Transcription Transcription

7 mRNA processing mRNA Processing (takes place in the nucleus)
Add 5’ cap (guanine with 3 phosphates) Add Poly A tail (repeated Adenines) Introns (non coding regions) cut out Exons (coding regions) fused together

8 snRNPs (small nuclear ribonucleoproteins)
snRNPs- small nuclear RNA RNA and proteins Spliceosome - several snRNPs that carry out RNA splicing Spliceosome Animation

9 Ribozyme Ribozyme – RNA that functions as an enzyme
Harvard Ribozymes Ribozyme – RNA that functions as an enzyme -splicing without proteins! How: Single stranded and forms 3-D structure Bases in RNA contain functional groups that may catalyze rxns. Forms hydrogen bonds Not all biological catalysts are proteins Thomas-Cech Ribozymes Sidney Altman Thomas Cech Yale U of Colorado

10 Animations

11 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

12 Translation Codons 3 nucleotides decoded into the sequence of amino acids

13 Translation in Prokaryotes
Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall

14 Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

15

16 Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

17 Translation in Eukaryotes

18 From gene to protein DNA mRNA protein transcription translation
aa transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

19 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20

20 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

21 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

22 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

23 Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids

24 Translation in Prokaryotes
Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall

25 Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

26

27 Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

28 Translation in Eukaryotes

29 From gene to protein DNA mRNA protein transcription translation
aa transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

30 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20

31 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

32 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? The wobble explains why the the synonymous codons for a given amino acid most often differ in their 3rd nucleotide base. Strong evidence for a single origin in evolutionary theory. Other amino acids are specified by more than one codon--usually differing at only the third position. The "Wobble Hypothesis,"discovered by Frances Crick, states that rules of base pairing are relaxed at the third position, so that a base can pair with more than one complementary base. Some tRNA anticodons have Inosine at the third position. Inosine can pair with U, C, or A. This means that we don't need 61 different tRNA molecules, only half as many. Start codon AUG methionine Stop codons UGA, UAA, UAG

33 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC Met GCA Arg amino acid CAU Val anti-codon

34 From gene to protein DNA mRNA protein transcription translation
aa transcription translation DNA mRNA protein ribosome nucleus cytoplasm

35 Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

36 tRNA – “Wobble” Inosine can pair with C, A, U allowing for less tRNA’s, More relaxed at the 3rd base position.

37 Loading tRNA Aminoacyl tRNA synthetase
enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

38 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
Structure ribosomal RNA (rRNA) & proteins 2 subunits large Small E P A Assembled in the nucleus of Eukaryotes

39 Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
Translation Animation McGraw Hill Ribosomes Uconn Translation Animation A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' G A U 3' E P A

40

41 Building a polypeptide
1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

42 Protein targeting Signal peptide address label Destinations: secretion
nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway

43 Can you tell the story? RNA polymerase DNA amino acids exon intron
tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Download ppt "Protein Synthesis Notes"

Similar presentations

From Gene to Protein How Genes Work

From Gene to Protein How Genes Work
From Gene to Protein Chapter 17 - Campbell.

From Gene to Protein Chapter 17 - Campbell.
Genes and Protein Synthesis

Genes and Protein Synthesis
DNA gets all the glory, but proteins do all the work!

DNA gets all the glory, but proteins do all the work!
Nucleic Acids Examples: Structure: RNA (ribonucleic acid)

Nucleic Acids Examples: Structure: RNA (ribonucleic acid)
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
From Gene to Protein.

From Gene to Protein.
Chapter 14. From Gene to Protein Biology 114.

Chapter 14. From Gene to Protein Biology 114.
FROM DNA TO PROTEIN Transcription – Translation We will use:

FROM DNA TO PROTEIN Transcription – Translation We will use:
Chapter 17~ From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Beadle and Tatum) One gene-one polypeptide (protein) hypothesis.

Chapter 17~ From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Beadle and Tatum) One gene-one polypeptide (protein) hypothesis.
From Gene to Protein Chapter 17 - Campbell What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are.

From Gene to Protein Chapter 17 - Campbell What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
Ch. 17 Lecture Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation replication protein RNA.

Ch. 17 Lecture Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation replication protein RNA.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
MCC BP Based on work by K. Foglia www.kimunity.com Chapter 17. From Gene to Protein.

MCC BP Based on work by K. Foglia Chapter 17. From Gene to Protein.
FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.

FROM DNA TO PROTEIN Transcription – Translation. I. Overview Although DNA and the genes on it are responsible for inheritance, the day to day operations.
AP Biology Lecture #33 Translation.

AP Biology Lecture #33 Translation.
Transcription Translation

Transcription Translation
From Gene to Protein How Genes Work

From Gene to Protein How Genes Work

Similar presentations

Ads by Google