Download presentation
Presentation is loading. Please wait.
1
From Gene to Protein How Genes Work
2
endoplasmic reticulum
TO: nucleus protein on its way! TO: DNA RNA vesicle TO: TO: vesicle ribosomes TO: protein finished protein Golgi apparatus Making Proteins
3
Metabolism taught us about genes
Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
4
One gene / one enzyme hypothesis
More recently it has been modified further research showed that not all proteins are enzymes… So it became one gene – one protein Even further research showed that most proteins are made up of two or more polypeptide chains So it now reads one gene – one polypeptide
5
Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
6
DNA gets all the glory, but proteins do all the work!
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication
7
from DNA nucleic acid language to RNA nucleic acid language
Transcribe: to make a written copy Transcription from DNA nucleic acid language to RNA nucleic acid language
8
Transcription Making mRNA transcribed DNA strand = template strand
untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5
9
Transcription in Prokaryotes
Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall
10
Transcription in Prokaryotes
Initiation RNA polymerase binds to promoter sequence on DNA The starting point for reading of the template strand
11
Transcription in Prokaryotes
Elongation RNA polymerase copies DNA as it unwinds ~20 base pairs at a time bases in gene builds RNA 53 Simple proofreading 1 error/105 bases make many mRNAs mRNA has short life not worth editing! reads DNA 35
12
Transcription in Prokaryotes
Termination RNA polymerase stops at termination sequence mRNA is ready for immediate use RNA GC hairpin turn
13
Transcription in Eukaryotes
RNA Processing Psssst… DNA can’t leave nucleus! Translation Protein
14
Transcription in Eukaryotes
3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes
15
Transcription in Eukaryotes
Initiation complex transcription factors bind to promoter region upstream of gene Set of proteins which bind to DNA turn on or off transcription TATA box binding site recognition site for transcription factors transcription factors trigger the binding of RNA polymerase to DNA
16
Post-transcriptional processing
Primary transcript (pre-mRNA) eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA) mRNA splicing = edit out introns protect mRNA from enzymes in cytoplasm add 5 cap add polyA tail 3' poly-A tail 3' A A A A A 5' cap mRNA A’s P P P 5' G eukaryotic RNA is about 10% of eukaryotic gene. 5’ cap = modified guanine Poly A tail = additional adenine nucleotides Functions of both: 1) facilitate export of mRNa out of nucleus, 2) protect mRNA from degradation by enzymes, 3) help enzymes attach to 5’ end once in cytoplasm intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
17
Discovery of Split genes
1977 | 1993 Discovery of Split genes Most eukaryotic genes, and therefore their RNA transcripts, have long noncoding stretches of nucleotides Many of these regions are found interspersed between coding segments creating split segments Introns: noncoding regions Exons: coding regions RNA splicing is removal of introns and joining of exons Richard Roberts Philip Sharp CSHL MIT
18
Splicing enzymes snRNPs Spliceosome several snRNPs
small nuclear RNA (snRNA) proteins Spliceosome several snRNPs recognize splice site sequence at either end of an intron cut & paste snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA snRNA is thought to catalyze this process No, not smurfs! “snurps”
19
Ribozyme 1982 | 1989 RNA as ribozyme some mRNA can even splice itself
RNA as enzyme Intron RNA functioning as a ribozyme and catalyzing its on excision Sidney Altman Thomas Cech Yale U of Colorado
20
from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language
21
Translation in Prokaryotes
Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall
22
Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
23
Translation in Eukaryotes
24
mRNA codes for proteins in triplets (codons)
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
25
The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
26
How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC Met GCA Arg amino acid CAU Val anti-codon
27
Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end
28
tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA 20 synthetases – each is specific for one of the amino acids Covalently bonds formed when ATP is hydrolyzed into AMP The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
29
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A
30
Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A
31
Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA (carrying methionine amino acid) Small subunit binds to 5’ cap of mRNA and scans down until reaches the start codon AUG Large subunit attaches Complete translation initiation complex Initiator tRNA moves to P site of ribosome Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'
32
Elongation adding amino acids based on codon sequence in the A site of the ribosome The anticodon of an incoming tRNA base pairs with the mRNA A peptide bond is formed between the new amino acid in A site and growing polypeptide in P site Polypeptide gets added to amino acid in a site tRNA in P site is moved to E site where it is released tRNA in A site moves to P site to allow a new tRNA to enter the ribosome
33
Termination Causes addition of water molecule to polypeptide chain
Occurs when a stop codon reaches the A site of the ribosome Either UAG, UAA or UGA Release factor, a protein, binds to the stop codon Causes addition of water molecule to polypeptide chain Breaks the bond between the polypeptide and tRNA in P site Releases polypeptide Val release factor Ser Ala Trp U 3' A C C U G G U A A 3'
34
Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing
35
Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome
Similar presentations
