Download presentation
Presentation is loading. Please wait.
1
Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? (What’s the verb?
2
Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? EXPLAIN
3
Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? EXPLAIN Explain the basic process of transcription AND translation. How they result in the expression of genes. EQ: Why is the sequence of nucleotides in DNA molecules so important?
4
Protein Synthesis 2 Main Steps:
Synthesis = the process of building or making something. Protein Synthesis = the process of building proteins. 2 Main Steps: Transcription (DNA RNA) Translation (RNA Protein)
5
The Players – Who is involved in protein synthesis?
DNA: Deoxyribose Nucleic Acid, Genetic Code to Life mRNA: Copy of the DNA, carries information in DNA out of the nucleus to make proteins. rRNA: Located on the ribosome. Reads the mRNA instructions. tRNA: Brings amino acids to mRNA in the ribosomes to create polypeptide chain. Amino Acids: Monomers of proteins. Polypeptide Chain: Polymer of proteins.
7
STEP 1: Transcription (DNA RNA)
What happens? mRNA is made (copied from DNA). Where? Occurs in the nucleus. How? The DNA strand is the template (pattern). Bases are matched up. CG GC T A A U (Instead of T)
8
STEP 1: Transcription (DNA RNA)
At the end of transcription, mRNA leaves the nucleus and goes into the cytoplasm to the ribosome (mRNA Nucleus Ribosome in Cytoplasm).
9
STEP 2: Translation (Translating the RNA Proteins)
What? Process by which information encoded in mRNA is used to assemble a protein. Where? Occurs on the ribosome in the cytoplasm of the cell. How? The mRNA is read (decoded) in groups of 3 nucleotides called codons. Codons are used to decode the message or translate the message to make proteins.
10
Who is involved in translation?
That’s A LOT of RNA The working instructions mRNA The reader ribosome (rRNA) The transporter transfer RNA (tRNA) The product amino acid chain (polypeptide or protein) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U
11
How does mRNA code for proteins? Not in the notes…
The ribosome “protein factory” builds proteins. The mRNA contains the instructions on how to build the proteins. BUT HOW? How? cytoplasm nucleus build proteins ribosome
12
Codons – The Code of Life
mRNA has the instructions, the instructions are CODONS. A Codon is… 3 Nucleotides Every 3 Nucleotides = 1 Amino Acid OR Every Codon = 1 Amino Acid Ribosomes “read” the mRNA codons and the tRNA retrieves the appropriate amino acid. Some codons are special… Start Codon: Signals the start of translation… Stop Codon: Signals the end of translation…
13
mRNA codes for proteins in triplets = Codon
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How do we know which amino acid it codes for ?
14
The Genetic Code Used to decode mRNA into amino acids. It is the same code for ALL living organisms. 3 Nucleotides = 1 Codon = 1 Amino Acid Amino acids can have more than one codon that codes for it. Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.
15
Using the codon chart to decode mRNA…
16
Check for Understanding: AUG, GGU, AND CAA
17
Different look, same idea. (Start in the center.)
Use this chart to Decode the following: ACC - Tht CUC - Leu GAA - Glu UAG - Stop
18
Translation: Let’s bring it all together!
DNA Replication: DNA copies itself. Transcription: mRNA is made from DNA in the nucleus. Translation: mRNA (from the nucleus) goes to the ribosome in the cytoplasm. rRNA reads the mRNA code (from the start codon) and tRNA retrieves and attaches the correct amino acid until the stop c odon is reached. The chain of amino acids builds a protein.
19
Proteins are the physical expression of our DNA
Proteins are the physical expression of our DNA. They are responsible for the visible variety of life found on Earth. Proteins synthesis is the SAME for all living organisms.
20
DNA structure is the same.
Just in a different order… mRNA is created the same. TRANSCRIPTION mRNA is read the same. TRANSLATION Same codon chart. Just different amount and order…
21
How genetic information flows from a DNA sequence to a protein product inside cells. This process of genetic information flowing from DNA to RNA to protein is called gene expression. The Central Dogma
23
We do – Protein Synthesis Foldable
Page 1 Page 2 Page 3 Page 4 Page 5 Page 6 DNA Strand 1 DNA Strand 2 Transcription When: Where: Why: How: mRNA Strand Amino Acid Translation When: Where: Why: How: DNA Strand 1 DNA Strand 2
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.