Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus

Similar presentations


Presentation on theme: "Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus"— Presentation transcript:

1 Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus
Cytoplasm Transcription Translation

2 Transcribing DNA Double stranded DNA unzips at Gene
Gene – a coding section of DNA Helicase is the enzyme that does the unzipping Helicase T G G T A C A G C T A G T C A T C G T A C C G T

3 Matching bases of DNA & RNA
U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

4 DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded
G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

5 Matching bases of DNA & RNA
RNA nucleotides, floating in nucleus, connect to DNA bases on one of the exposed DNA strands Nucleotide – a phosphate, a sugar, a base RNA Polymerase is the enzyme that attaches them together A C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

6 From nucleus to cytoplasm
transcription DNA mRNA cytoplasm

7 Translation - mRNA to Protein
The Instructions  mRNA The Reader  Ribosome The Transporter of Amino Acids  Transfer RNA (tRNA) mRNA U C A G aa tRNA ribosome C

8 mRNA to protein = Translation
amino acid chain tRNA drops off it’s Amino Acid tRNA then goes back into the cytoplasm, to pick up another amino acid. All 20 Amino Acids are floating free and waiting in the Cytoplasm. The amino acid chain is left to become the functioning Protein. cytoplasm mRNA

9 From mRNA to Protein DNA mRNA translation transcription nucleus
tRNA translation transcription DNA mRNA nucleus cytoplasm

10 mRNA codes for amino acids in triplet bases (codons)
TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein amino acids (aa) Codon = block of 3 mRNA bases

11 The mRNA Codon Chart For ALL life! Code has duplicates Start codon
several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

12 DNA  Proteins  Cells  Bodies
DNA has the information to build proteins Genes - DNA coding sections proteins cells DNA DNA gets all the glory, Proteins do all the work bodies

13 How do proteins do all the work
Proteins run and make living organisms Enzymes – protein catalysts control all chemical reactions in living organisms Structure all living organisms are built out of proteins

14 and 20 amino acids Code for ALL life on Earth
Only 4 DNA bases (A,U,G,C) and 20 amino acids Code for ALL life on Earth TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa

15 for Protein Synthesis! It’s Growth It’s Repair It’s YOU


Download ppt "Protein Synthesis DNA Gene mRN tRNA Amino Acid Protein Nucleus"

Similar presentations


Ads by Google