Ch 17 - From Gene to Protein

Ch 17 - From Gene to Protein

What do genes code for? How does DNA code for cells & bodies? DNA
how are cells and bodies made from the instructions in DNA? DNA proteins cells bodies

transcription and translation
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation replication

From gene to protein DNA mRNA protein trait cytoplasm nucleus
aa cytoplasm nucleus transcription translation DNA mRNA protein ribosome trait

from DNA nucleic acid language to RNA nucleic acid language
Transcription from DNA nucleic acid language to RNA nucleic acid language

RNA DNA RNA ribose sugar N-bases single stranded lots of types of RNA
uracil instead of thymine U : A C : G single stranded lots of types of RNA mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

Transcription Making mRNA transcribed DNA strand = template strand
Transcription bubble – site of synthesis of complementary RNA strand Enzyme used : RNA polymerase 3 A G C A T C G T 5 A G A A C A G T T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

Which gene is read? Promoter region
binding site before beginning of gene’s DNA sequence Includes TATA box binding site binding site for RNA polymerase & transcription factors

Initiating Transcription
Initiation complex has to form for transcription to start transcription factors bind to promoter region suite of proteins which bind to DNA turn on or off transcription trigger the binding of RNA polymerase to DNA

Once transcription starts :
RNA bases are matched to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Introns and Exons Eukaryotic genes include non-coding regions called introns exons = the real gene expressed / coding DNA introns = intervening sequences (not part of the gene) intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Newly formed mRNA transcript includes introns and exons
1st type of post-transcriptional processing must occur mRNA splicing edit out introns eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

RNA splicing enzymes snRNPs Spliceosome several snRNPs
small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA

Alternative splicing can occur
Alternative mRNAs can be produced from same length of DNA

More post-transcriptional processing
Need to protect mRNA on its trip from nucleus to cytoplasm If not protected, enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail A 3' poly-A tail mRNA 5' 5' cap 3' G P A’s eukaryotic RNA is about 10% of eukaryotic gene.

From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons
support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Transfer RNA (tRNA) structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site P site E site (exit site)
holds tRNA carrying next amino acid to be added to chain P site holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met A C 5' U A U G 3' E P A

Building a polypeptide
1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

start of a secretory pathway
Protein targeting Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide added address label start of a secretory pathway

DNA amino acids pre-mRNA 3' 5' E P A ribosome
RNA polymerase DNA amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

exons transcription start introns transcription stop promoter
enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start UTR introns transcription stop UTR promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA

Protein Synthesis in Prokaryotes
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Cell membrane Cell wall

Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes physical separation between processes no RNA processing in prokaryotes

Mutations Mutations are changes in the genetic material of a cell or virus Point mutations are chemical changes in just one base pair of a gene The change of a single nucleotide in a DNA template strand can lead to the production of an abnormal protein 35

Sickle-cell hemoglobin Wild-type hemoglobin DNA Sickle-cell hemoglobin
Figure 17.23 Wild-type hemoglobin Sickle-cell hemoglobin Wild-type hemoglobin DNA Mutant hemoglobin DNA 3 C T T 5 3 C A T 5 5 G A A 3 5 G T A 3 mRNA mRNA 5 G A A 3 5 G U A 3 Figure The molecular basis of sickle-cell disease: a point mutation. Normal hemoglobin Sickle-cell hemoglobin Glu Val

Types of Small-Scale Mutations
Point mutations within a gene can be divided into two general categories Nucleotide-pair substitutions One or more nucleotide-pair insertions or deletions 37

Substitutions A nucleotide-pair substitution replaces one nucleotide and its partner with another pair of nucleotides Silent mutations have no effect on the amino acid produced by a codon because of redundancy in the genetic code Missense mutations still code for an amino acid, but not the correct amino acid Nonsense mutations change an amino acid codon into a stop codon, nearly always leading to a nonfunctional protein 38

(a) Nucleotide-pair substitution
Figure 17.24 Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (a) Nucleotide-pair substitution (b) Nucleotide-pair insertion or deletion A instead of G Extra A 3 T A C T T C A A A C C A A T T 5 3 T A C A T T C A A A C C G A T T 5 5 A T G A A G T T T G G T T A A 3 5 A T G T A A G T T T G G C T A A 3 U instead of C Extra U 5 A U G A A G U U U G G U U A A 3 5 A U G U A A G U U U G G C U A A 3 Met Lys Phe Gly Met Stop Stop Silent (no effect on amino acid sequence) Frameshift causing immediate nonsense (1 nucleotide-pair insertion) T instead of C A missing 3 T A C T T C A A A T C G A T T 5 3 T A C T T C A A C C G A T T 5 T 5 A T G A A G T T T A G C T A A 3 5 A T G A A G T T G G C T A A 3 A A instead of G U missing 5 A U G A A G U U U A G C U A A 3 5 A U G A A G U U G G C U A A 3 Figure Types of small-scale mutations that affect mRNA sequence. Met Lys Phe Ser Stop Met Lys Leu Ala Missense Frameshift causing extensive missense (1 nucleotide-pair deletion) A instead of T T T C missing 3 T A C A T C A A A C C G A T T 5 3 T A C A A A C C G A T T 5 5 A T G T A G T T T G G C T A A 3 5 A T G T T T G G C T A A 3 U instead of A A A G missing 5 A U G U A G U U U G G C U A A 3 3 5 A U G U U U G G C U A A 3 U A A Met Stop Met Phe Gly Stop Nonsense No frameshift, but one amino acid missing (3 nucleotide-pair deletion)

(a) Nucleotide-pair substitution: silent
Figure 17.24a Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (a) Nucleotide-pair substitution: silent A instead of G 3 T A C T T C A A A C C A A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G A A G T T T G G T T A A 3 U instead of C 5 A U G A A G U U U G G U U A A 3 Met Lys Phe Gly Stop

(a) Nucleotide-pair substitution: missense
Figure 17.24b Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (a) Nucleotide-pair substitution: missense T instead of C 3 T A C T T C A A A T C G A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G A A G T T T A G C T A A 3 A instead of G 5 A U G A A G U U U A G C U A A 3 Met Lys Phe Ser Stop

(a) Nucleotide-pair substitution: nonsense
Figure 17.24c Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (a) Nucleotide-pair substitution: nonsense A instead of T T instead of C 3 T A C A T C A A A C C G A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G T A G T T T G G C T A A 3 U instead of A 5 A U G U A G U U U G G C U A A 3 Met Stop

Insertions and Deletions
Insertions and deletions are additions or losses of nucleotide pairs in a gene These mutations have a disastrous effect on the resulting protein more often than substitutions do Insertion or deletion of nucleotides may alter the reading frame, producing a frameshift mutation 43

Figure 17.24d Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (b) Nucleotide-pair insertion or deletion: frameshift causing immediate nonsense Extra A 3 T A C A T T C A A A C G G A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G T A A G T T T G G C T A A 3 Extra U 5 A U G U A A G U U U G G C U A A 3 Met Stop 1 nucleotide-pair insertion

Figure 17.24e Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (b) Nucleotide-pair insertion or deletion: frameshift causing extensive missense A missing 3 T A C T T C A A C C G A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G A A G T T G G C T A A 3 U missing 5 A U G A A G U U G G C U A A 3 Met Lys Leu Ala 1 nucleotide-pair deletion

Figure 17.24f Wild type DNA template strand 3 T A C T T C A A A C C G A T T 5 5 A T G A A G T T T G G C T A A 3 mRNA5 A U G A A G U U U G G C U A A 3 Protein Met Lys Phe Gly Stop Amino end Carboxyl end (b) Nucleotide-pair insertion or deletion: no frameshift, but one amino acid missing T T C missing 3 T A C A A A C C G A T T 5 Figure Types of small-scale mutations that affect mRNA sequence. 5 A T G T T T G G C T A A 3 A A G missing 5 A U G U U U G G C U A A 3 Met Phe Gly Stop 3 nucleotide-pair deletion

Ch 17 - From Gene to Protein

Similar presentations

Presentation on theme: "Ch 17 - From Gene to Protein"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Ch 17 - From Gene to Protein

Similar presentations

Presentation on theme: "Ch 17 - From Gene to Protein"— Presentation transcript:

Similar presentations

About project

Feedback