Presentation is loading. Please wait.

Presentation is loading. Please wait.

Translation Unit 5B.4.

Similar presentations


Presentation on theme: "Translation Unit 5B.4."— Presentation transcript:

1 Translation Unit 5B.4

2 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

3 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

4 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

5 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

6 WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT
1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

7 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

8 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

9 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

10 Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

11 tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

12 Protein synthesis/quiz
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

13 Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
Protein synthesis 2 Ribosomes A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' A U G 3' E P A

14 Building a polypeptide
1 2 3 How translation works Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G C U A C 5' U A C G A C U A C G A C G A C 5' A 5' U A A U G C U G A U A U G C U G A A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

15 start of a secretory pathway
Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

16 Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

17 The Transcriptional unit (gene?)
enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start UTR introns transcription stop UTR promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA

18 Protein Synthesis in Prokaryotes
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall

19 Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

20 Translation in Prokaryotes
Transcription & translation are simultaneous (coupled) in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

21 Translation: prokaryotes vs. eukaryotes
SEE PROCESSING VIDEO Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

22 COMPLETING PROTEINS POLYRIBOSOMES (POLYSOMES)
Numerous ribosomes translate same mRNA at same time 3-D folding (1’, 2’, 3’ structure) Chaparonins


Download ppt "Translation Unit 5B.4."

Similar presentations


Ads by Google