Modern genetics

Modern genetics DNA is responsible for inherited traits DNA also controls the cell’s functions DNA is involved in both replication and protein synthesis.

DNA Replication

Steps of DNA replication 1. DNA uncoils 2. Free nucleotides attach to appropriate base pairing 3. Two new DNA strands are made 4. Recoiling of two new exact copies of DNA

Uncoiling and recoiling

Two new identical dna strands

Remember base pairs

Protein synthesis DNA in the nucleus contains the code to control the cell’s functions. DNA directs the construction of proteins in the __________.

Protein synthesis Involves mRNA and tRNA

mRNA Messenger RNA Single stranded Contains bases A-U and G-C Small size

mRNA mRNA enters and leaves nucleus easily mRNA copies DNA (almost) This step is called transcription. DNA is said to be transcribed

Transcription DNA Code is passed to mRNA

Translation In this step mRNA goes to the ribosome The mRNA carries a codon (3 bases) into the ribosome Within the ribosome the mRNA meets up with tRNA

Picture of tRNA

tRNA Carries specific amino acids into ribosome from cytoplasm Has an anti-codon to translate the mRNA code

Translation of mRNA

Construction of a protein

Base codes for amino acids

Protein synthesis

GENE MUTATIONS Any change in the base sequence of an organism’s DNA Deletion: missing a piece Addition: contains a repeated piece Translocation: contains a piece from another chromosome Inversion: order is reversed Substitution: incorrect base is inserted

GENETIC ENGINEERING Scientists can change genes. This is called genetic engineering. Ex. Tobacco plant and firefly Types of Genetic Engineering: Cloning Recombination

CLONING Cloning Producing genetically identical cells One parent cell can be cloned to produce an entire organism Ex. Skin grafting, Dolly

DOLLY & BONNY

DOLLY

RECOMBINANT DNA Transferring genes from one organism to another.

RECOMBINANT DNA- HUMAN GROWTH HORMONE (HGH)

RECOMBINANT DNA Why? Can be used to produce insulin for diabetic patients. Can be used to make human growth hormones in a lab.

HUMAN GENOME PROJECT taattctcccctctgcttgtttcccccttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta taattctcccctctgcttgaaatttcccccttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta taattctcccctctgcttgtttccccggcttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta Taattctcccctctgcttgtttcccccttaaaatattcgcgtaacccccggggcccccttatagcagatacattacgattagcattandsoon…

HUMAN GENOME PROJECT Map of human gene locations.