Regents Biology Turn in DNA letter  Begin reading Analogy Story and answer the questions  Don’t worry about the back page

Regents Biology Watch animation  Ask questions if something is unclear  Then we’ll take a few notes about what we discussed  Tomorrow you’ll take what we learned to decode genetic instructions, find out what a fictional creature looks like based on the instructions and draw it.

Regents Biology Protein Synthesis Making Proteins

Regents Biology  Bodies are made up of cells  All cells run on a set of instructions spelled out in DNA Bodies  Cells  DNA

Regents Biology  How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA  Cells  Bodies

Regents Biology  DNA has the info to build proteins DNA  Proteins  Cells  Bodies proteins cells bodies DNA gets all the glory, Proteins do all the work

Regents Biology How do proteins do all the work  Proteins  proteins run living organisms  enzymes  control all chemical reactions in living organisms  structure  all living organisms are built out of proteins

Regents Biology cytoplasm nucleus Cell organization  DNA  DNA is in the nucleus  genes = instructions for making proteins  want to keep it there = protected  “locked in the vault”

Regents Biology Cell organization  Proteins  chains of amino acids  made by a “protein factory” in cytoplasm  protein factory = ribosome nucleus cytoplasm ribosome build proteins

Regents Biology Passing on DNA information  Need to get DNA gene information from nucleus to ribosome  The code to make protein is in DNA.  Since DNA can’t leave the nucleus a copy called mRNA is made, which is sent to the ribosome to then make protein nucleus cytoplasm ribosome mRNA build proteins

Regents Biology mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein

Regents Biology DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T : A  C : G  double stranded RNA  ribose sugar  nitrogen bases  G, C, A, U  U : A  C : G  single stranded

Regents Biology Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

Regents Biology Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

Regents Biology Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A

Regents Biology Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

Regents Biology Once a copy is made in the nucleus mRNA goes to the ribosome TRANSLATION: ribosome decodes the instructions on mRNA and makes a protein

Regents Biology How does mRNA code for proteins  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

Regents Biology Codes are written in groups of 3 letters (codon) TAC GCA DNA AUG CGU mRNA tRNA Met tRNA Arg codon

Regents Biology mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

Regents Biology protein transcription cytoplasm nucleus translation trait

Regents Biology Whoops! See what happens when your genes don’t work right! Any Questions??