Presentation is loading. Please wait.

Presentation is loading. Please wait.

DO NOW.

Similar presentations


Presentation on theme: "DO NOW."— Presentation transcript:

1 DO NOW

2 Study for Quiz What is the cell cycle? Describe cancer cells.
What is interphase? What happens in G1? G2? S? When does interphase happen? What is the purpose of mitosis? What is the product of mitosis? What happens in P? M? A? T? What is the purpose of meiosis? What is the product of meiosis? What happens in P1? M1? A1? T1? What happens in P2? M2? A2? T2?

3 Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? (What’s the verb?

4 Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? EXPLAIN

5 Protein Synthesis - Making Proteins
SC.912.L.16.5 Explain the basic processes of transcription and translation and how they result in the expression of genes What do we have to do? EXPLAIN Explain the basic process of transcription AND translation. How they result in the expression of genes.

6

7 Proteins Review Proteins are chains of amino acids = polypeptide
Proteins run living organisms Enzymes control all chemical reactions in living organisms Structure all living organisms are built out of proteins made by a “protein factory” in cytoplasm protein factory = ribosome In cytoplasm cytoplasm nucleus build proteins ribosome

8 Proteins and DNA Our body is constantly making proteins
mRNA Our body is constantly making proteins Proteins do all the “work” Where do we find the instructions for making proteins? DNA The DNA is a code for protein construction How do we read the DNA code for making proteins? Protein synthesis! We read the DNA “code” in small sections (genes) when we need to make a new protein. (All the time!) Each gene = new protein Protein

9 DNA Review DNA is in the nucleus DNA Structure
Contains genes = instructions for making proteins DNA Structure Made of nucleotides Adenine (A) Guanine (G) Cytosine (C) Thymine (T) cytoplasm nucleus

10 Protein Synthesis 2 Main steps:
Synthesis = the process of building or making something Protein synthesis = the process of building proteins. 2 Main steps: Transcription (DNA  RNA) Translation (RNA  Protein)

11 Key Point #1 – DNA must be copied DNA mRNA
Imagine you are an architect of a very special building, would you let your only set of blue prints leave with the builder? DNA does not leave the nucleus, so in order to make proteins, we need to make a copy = messenger RNA (mRNA) Transcription is the process of copying the DNA to mRNA Occurs in the nucleus Once complete the mRNA travels to the cytoplasm to be read by the ribosome We call this process Transcription because the DNA code is being transcribed.

12 Key Point #1: Transcription Overview DNA (Nucleus)  mRNA (Cytoplasm)
protein translation Ribosome trait

13 Transcription Key Point #2 DNA vs. RNA
deoxyribose sugar nitrogen bases G, C, A, T T : A C : G Double stranded Stays in the nucleus RNA ribose sugar nitrogen bases G, C, A, U U : A C : G Single stranded Created in the nucleus Can leave the nucleus

14 Protein Synthesis: Transcription (Making a copy of DNA  RNA)
How does transcription work? DNA strand is the template (pattern) match bases (uracil instead of thymine) CG GC T A A U (instead of T) RNA polymerase = Enzyme Helper molecule Similar to what process? DNA replication Except we are only making 1 strand and replacing the T with U

15 What does transcription look like???
Transcription Step 1 Double stranded DNA unzips A G T C A G T C

16 Transcription Step 2 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC DNA
Match RNA bases to DNA bases on one of the DNA strands Uracil instead of Thymine is matched to A TACGCACATTTACGTACGCGG U DNA A G C RNA polymerase U AUGCGUGUAAAUGCAUGCGCC mRNA A G A C C T G G T A C A G C T A G T C A T C G T A C C G T mRNA exits the nucleus through the nuclear pore to the ribosomes in the cytoplasm.

17 Matching bases of DNA & RNA
U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Preview of Translation – next class!!! ribosome U C A G

18 cytoplasm protein nucleus ribosome U C A G trait

19 Lets Practice DNA STRAND: GAATTACA CCAATTAG ATAGACAG CCAGTACA

20 Create the following table onto LEFT page
DNA BOTH RNA

21 Create the following diagram on the LEFT page
DNA Both RNA Create the following diagram on the LEFT page

22 Compare and Contrast DNA and RNA
contains genetic information used in transcription Can leave the nucleus double stranded cannot leave the nucleus single stranded made up of phosphates, sugars and nitrogen bases A=U A=T use G, C and A used in DNA Replication uses the sugar ribose uses the sugar deoxyribose Sort the following bullets into the category it should go into the chart you just made.

23 DNA Both RNA Both are used in transcription Double stranded
Made up of phosphates, sugars and nitrogen bases Contain genetic information Use G, C and A Double stranded A=T Uses the sugar deoxyribose Cannot leave the nucleus Used in DNA Replication Single stranded A=U Uses the sugar ribose Can leave the nucleus Used in translation


Download ppt "DO NOW."

Similar presentations


Ads by Google