Presentation is loading. Please wait.

Presentation is loading. Please wait.

Get out worksheet from yesterday and Nucleotides

Similar presentations


Presentation on theme: "Get out worksheet from yesterday and Nucleotides"— Presentation transcript:

1 Get out worksheet from yesterday and Nucleotides
Combine the nucleotides of your choice to create one strand of DNA Then create the compliment strand of DNA Compare your strand to your to your neighbors strand and finish the worksheet.

2 Protein Synthesis Warm Up
What is a code? How does a code work? What do you think “genetic code” means?

3 RNA vs. DNA RNA DNA ribose sugar nitrogen bases single stranded
G, C, A, U U : A C : G single stranded Found inside & outside the nucleus DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded Only found inside the nucleus

4 Based on what you know about DNA and RNA, describe what you see happing to the DNA molecule in the image to the left.

5 Protein Synthesis Protein Making

6 Goal Understand the Overall process of protein synthesis (transcription + translation) Know the Roles DNA mRNA tRNA

7 Organelles used in Protein Synthesis

8 Protein Synthesis is the process (steps) of sharing the information in the genes of DNA out of the nucleus to the ribosomes to create proteins, which create your traits

9 Protein Synthesis DNA can’t get out! cytoplasm build proteins mRNA
Read DNA blueprint Create a (single strand) mRNA copy Leave Nucleus Goes to Ribosome (cytoplasm) Ribosome reads RNA tRNA brings amino acid Ribosome combines amino acids cytoplasm nucleus DNA can’t get out! build proteins mRNA ribosome

10 Draw this in your spiral
Cell Ribosome DNA mRNA protein trait nucleus

11 Draw this in your spiral
Cell Ribosome DNA mRNA protein trait nucleus

12 Protein Synthesis Story Time
It was Christmas time in the land of Celltopia. There was a princess stuck in her Nucastle because of a broken foot. She really wanted a the gift of blonde hair and green eyes, but she would never make it in time to Santa’s Ribo factory!! So she came up with the idea to write her Christmas list down and give it to her guard. The guard took off with her list on his horse to find one of Santa’s elves who worked in the ribo-facotry and he immediately began reading her list and producing her blonde hair present, and green eye present. On Christmas morning the princess woke up and opened her presents, “yay!!!!” she exclaimed, she now had blonde hair and green eyes!!

13 Correctly Match the photos from the story to your diagram.
Cell Ribosome DNA mRNA protein trait nucleus

14 From nucleus to cytoplasm
transcription translation DNA mRNA protein trait nucleus cytoplasm

15 First Step - Transcription
DNA mRNA First Step - Transcription Transcribes DNA to mRNA DNA strand is the template (pattern) match bases U : A G : C mRNA leaves nucleus into cytoplasm

16 2nd Step – Translation mRNA to protein
mRNA converted to protein shapes in the ribosome Ribosome read 3 nitrogen bases at a time Codon: 3 nitrogen bases creates 1 amino acid tRNA brings the amino acid Rib

17 Protein Synthesis = Transcription + Translation

18 Get out the Diagram from Friday
In your table groups complete the transcription translation diagram

19 Check Point! Match the analogies to the appropriate biological structure. The Blueprint The instructions The reader The transporter Word Bank DNA tRNA Ribosome mRNA DNA (blueprint) provides the information, the mRNA (instructions) copies the message, the ribosome (reader) de codes the message, and the tRNA (transporter) brings one amino acid to the ribosome over and over again to build a protein.

20 Answer the following questions
Name the two steps of protein synthesis (in order). What is the role of DNA in protein synthesis? What is the role of mRNA? What is the role of tRNA (use the word amino acid &protein)? How is DNA transcribed? During translation, how does mRNA produce proteins?

21 Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

22 Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands U instead of T is matched to A C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

23 Matching bases of DNA & RNA
U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

24 cytoplasm protein nucleus ribosome U C A G trait

25 The mRNA code For ALL life! Code has duplicates Start codon
strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

26 How are the codons matched to amino acids?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

27 DNA mRNA protein trait From gene to protein tRNA transcription
aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

28

29

30

31 Protein Synthesis Activity!!

32 From gene to protein protein transcription translation


Download ppt "Get out worksheet from yesterday and Nucleotides"

Similar presentations


Ads by Google