DNA and Protein Synthesis A Brief Tutorial

Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of life.” Sometimes called “the blueprint of life.” Used to help build everything the organism needs to function. Used to help build everything the organism needs to function. Must remain in the nucleus. Must remain in the nucleus.

Structure of DNA Nucleotide Nucleotide 5 carbon sugar + phosphate group + nitrogenous base 5 carbon sugar + phosphate group + nitrogenous base DNA sugar = deoxyribose DNA sugar = deoxyribose Nitrogenous Bases = adenine, thymine, cytosine, guanine Nitrogenous Bases = adenine, thymine, cytosine, guanine Nucleotides are linked together into shape of double-helix. Nucleotides are linked together into shape of double-helix. Twisted Ladder Analogy Twisted Ladder Analogy

Science Aid: DNA Structure and Replication scienceaid.co.uk/biology/genetics2/dna.html DNA is really a pattern of repeating nucleotides. LADDER ANALOGY A DNA Sequence

Latest from the Labs: Cells and DNA info.cancerresearchuk.org/.../cellsanddna/ The DNA molecule needs to coil and fold- up so that it can fit into the small nucleus. The Ladder The Double Helix

Complementary Base-Pairing DNA molecule is double-stranded and “complementary” DNA molecule is double-stranded and “complementary” Adenine always pairs with Thymine (A=T) Adenine always pairs with Thymine (A=T) Cytosine always pairs with Guanine (G =C) Cytosine always pairs with Guanine (G =C) Backbone/rails = alternating sugar/phosphate molecules Backbone/rails = alternating sugar/phosphate molecules

Practice DNA Strands ATCCGTGCT ATCCGTGCT GCGTAGCTGACCGCGATGACA GCGTAGCTGACCGCGATGACA

DNA Replication How DNA makes a copy of itself How DNA makes a copy of itself Semi-conservative Replication Semi-conservative Replication 2 New DNA molecules each with 1 old strand and 1 new strand 2 New DNA molecules each with 1 old strand and 1 new strand DNA Ladder unzips, enzymes come in and add new base pairs…. 2 new molecules! DNA Ladder unzips, enzymes come in and add new base pairs…. 2 new molecules! ANIMATION! ANIMATION! ANIMATION!

DNA, RNA, and Protein Main Idea: DNA codes for RNA, which helps build proteins.

Central Dogma How does the information stored in DNA get expressed in genes? How does the information stored in DNA get expressed in genes? DNA  RNA  Protein DNA  RNA  Protein RNA is able to take the information stored in DNA out of the nucleus and go to the ribosome to help build proteins! RNA is able to take the information stored in DNA out of the nucleus and go to the ribosome to help build proteins!

RNA 5 carbon sugar = ribose 5 carbon sugar = ribose Nitrogenous bases = adenine, uracil, cytosine, and guanine Nitrogenous bases = adenine, uracil, cytosine, and guanine Single (not double) stranded Single (not double) stranded 3 different forms: 3 different forms: mRNA – messenger RNA mRNA – messenger RNA tRNA- transfer RNA tRNA- transfer RNA rRNA- ribosomal RNA rRNA- ribosomal RNA

Transcription DNA  mRNA DNA  mRNA Information in DNA gets transcribed (or rewritten) into RNA language. Information in DNA gets transcribed (or rewritten) into RNA language. C pairs with G C pairs with G A pairs with U A pairs with U Sample Transcription: AGCGTGAACGT Sample Transcription: AGCGTGAACGT Next, mRNA shuttles its message to the ribosome Next, mRNA shuttles its message to the ribosome

Translation mRNA  Protein mRNA  Protein At the ribosome, information stored in mRNA molecule gets translated into a chain of amino acids (protein) with the help of tRNA. At the ribosome, information stored in mRNA molecule gets translated into a chain of amino acids (protein) with the help of tRNA.

Steps Break mRNA molecule into 3 bases = codon Break mRNA molecule into 3 bases = codon Use the codon chart to determine what amino acid the tRNA molecule would bring to the ribosome to help build the protein. Use the codon chart to determine what amino acid the tRNA molecule would bring to the ribosome to help build the protein.

Protein Synthesis DNA Strand: AGTACCGCGTCATT DNA Strand: AGTACCGCGTCATT Transcription Product: Transcription Product: Translation Product: Translation Product: ANIMATE! ANIMATE! ANIMATE!

Mutations A permanent change in the DNA of a cell A permanent change in the DNA of a cell Missense mutation: change in DNA results in wrong amino acid placed in protein. (Might still be ok….) Missense mutation: change in DNA results in wrong amino acid placed in protein. (Might still be ok….) Nonsense mutation: change in DNA causes translation to stop early. (VERY BAD) Nonsense mutation: change in DNA causes translation to stop early. (VERY BAD)

Point mutation  base substitution (C instead of G) Point mutation  base substitution (C instead of G) Addition/Deletion  “Frame shifts”… cause change the multiple of three codons Addition/Deletion  “Frame shifts”… cause change the multiple of three codons Tandem Repeats  excessive repeating of sequences. Tandem Repeats  excessive repeating of sequences. Multiple Choice (Scantron) Analogy Multiple Choice (Scantron) Analogy