From Gene to Protein How Genes Work 2007-2008

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

Remember the “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation Now its time to focus on translation! replication

Remember: The Ribosome is the site of protein synthesis – where proteins are MADE Proteins are POLYMERS Proteins are made of AMINO ACID MONOMERS Therefore, if proteins are going to be made, some thing has to bring amino acids to the “protein factory” AND they need to assemble the amino acids into the correct structure to make the needed protein!

DETAIL ON TRANSLATION The completed and processed mRNA molecule goes to the ribosome to be translated. The image shows the mRNA coming together with the 2 subunits (large and small) that make up the ribosome. Remember that this occurs in the cytoplasm (rough ER)

But how do we know what amino acid goes where??? THE GENETIC CODE Carried by the mRNA from the DNA Based on the order of the nucleotides

The code Same code is used for ALL life! strongest support for a common origin for all life mRNA carries the genetic message from the DNA in the form of codons Strong evidence for a single origin in evolutionary theory.

The Genetic Code 3 nucleotides are required to code for 1 amino acid The Triplet Code: The genetic instructions for a polypeptide chain are written in the DNA as a series of non-overlapping, three-nucleotide words. There are 64 code “words” in the triplet code. Each triplet is called a CODON.

The Genetic Code Each different codon codes for a different amino acid UGG codes for Trp (tryptophan) Codons are read by the ribosome in the 5’ to 3’ direction

The Genetic Code Special Codons Start Codon Stop Codons Always AUG Codes for amino acid methionine (met) Tells ribosome where to begin translating Thus, “met” is always the first amino acid in any polypeptide Stop Codons UAA, UAG and UGA Tell the ribosome to stop translating Code for NO amino acids

One more player…tRNA Once the mRNA and ribosome have come together, a third molecule is still required to “interpret” the mRNA message. This is tRNA. The “t” in tRNA stands for transfer tRNA transfers amino acids to the ribosome. There are many tRNA floating about in the cytoplasm. Each of these tRNA molecule is carrying around one of the 20 different amino acids. A cell keeps up its supply of amino acids either by Manufacturing them itself Taking them up from the surrounding solution

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

tRNA structure anticodon This sequence is complementary to one of the different codons on mRNA that code for amino acids and binds to it.

Example If the mRNA codon is UUU, then the tRNA anticodon that will “plug into” this codon is AAA. Any tRNA molecule with this anticodon (AAA) will always carry the amino acid Phe (phenylalanine) which is what the UUU mRNA codon calls for (see the genetic code chart).

Making the polypeptide As the genetic message is translated, the tRNAs deposit amino acids in the order needed, and the ribosome joins the amino acids into a chain.

Loading tRNA w/ correct amino acid Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

How do amino acids get hooked to the correct tRNAs? There is an enzyme called aminoacyl-tRNA synthetase – actually there are 20 versions of this enzyme – one for each of the 20 different amino acids The active sites of each of these enzymes fits only a specific combination of amino acid and tRNA Once bound, the synthetase catalyzes the covalent attachment of an amino acid to its appropriate tRNA This process is driven by ATP.

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) – ACTIVE site holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) – PASSIVE site holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

rRNA or Protein – which one makes the ribosome work? Ribosomes are made of both rRNA and protein rRNA is most responsible for ribosomal structure and function Ribosome is one big ribozyme RNA acting as catalyst

Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

Translation - Initiation Components brought together mRNA Two ribosomal subunits tRNA Bearing the first amino acid of the polypeptide that will be made Remember this is always “met” met

Translation - Initiation mRNA attaches to small ribosomal subunit and… tRNA carrying “met” amino acid Small subunit then moves downstream along the mRNA until it encounters the start codon (AUG) This establishes the reading frame. The anticodon of the initiator tRNA (w/ “met”) then hydrogen bonds with the start codon on mRNA

Translation - Initiation After mRNA, tRNA and small subunit unite… Large ribosomal subunit attaches This completes the translation initiation complex Initiation factors Proteins Bring all components together Energy used GTP At this point the initiator tRNA is sitting on the P site of the ribosome. The A site is vacant and waits for the next tRNA to arrive

Translocation - Elongation 3 Parts Codon Recognition Peptide Bond Formation Translocation

Translation - Elongation Codon recognition Anitcodon of incoming tRNA base pairs with the complementary mRNA sequence which is at the A site of the ribosome

Codon recognition

Translation - Elongation Peptide bond formation Peptide bond is formed between the new amino acid at the A site and the old amino acid that has been waiting at the P site This step removes the amino acid from the tRNA at the P site and adds it to the amino acid at the A site Thus the polypeptide chain begins to grow

Peptide bond formation

Translation - Elongation Translocation tRNA moves from the A site to the P site tRNA at the P site moves to the E site where it is released mRNA moves along to bring the next codon to the A site.

Translocation – Everything shifts over

Translation - Termination Elongation continues until a stop codon is reached UAA, UAG, UGA Release factor Protein Binds to stop codon at A-site Causes addition of water instead of amino acid to polypeptide Releases the polypeptide from the tRNA at the P-site Remainder of the whole assembly comes apart

Polyribosomes Multiple ribosomes translating the same piece of mRNA

Modifications of Polypeptides to make FUNCTIONAL Proteins During synthesis, polypeptides begin to fold spontaneously Creates specific shape (conformation) Structure Gene determines primary structure Primary structure determines conformation Chaperone proteins May help the protein to fold correctly Post-translational modifications Amino acids may be modified, removed Polypeptide may be cleaved 2 or more polypeptides may come together (quaternary structure)

start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

Multiple Roles of RNA in Cells mRNA - carries information specifying amino acid sequences of proteins from DNA to ribosomes. tRNA - translates mRNA codons into amino acids rRNA - plays catalytic (ribozyme) AND structural roles in ribosomes. Primary transcript - precursor to mRNA (or rRNA or tRNA), before being processed by splicing, etc. Small nuclear RNA (snRNA)- plays structural and catalytic roles in spliceosomes. SRP RNA - component of the SRP that recognizes the signal peptides of polypeptides targeted to ER. Small nucleolar RNA- aids in process pre-rRNA transcripts for making ribosome subunits in the nucleolus. Small interferring RNA and microRNA - involved in determining which genes get expressed in a cell.

How Come RNA Can Do So Many Different Things? Because of 3 properties: RNA can hydrogen bond to other nucleic acids RNA can assume a specific 3-dimensional shape These can form hydrogen bonds between bases in different parts of the RNA’s own nucleotide chain Results in complex folding RNA has functional groups that allow it to act as a catalyst (ribozymes) Bottom Line: RNA is much more versatile than DNA

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome