1. Translation & Mutations
Bio 391
; 15.4

2. Translation The mRNA leaves the nucleus  cytoplasm
Message is read at the ribosome
1 Codon (3 letter message) is translated into 1 amino acid
tRNA molecule has one end (anticodon) that matches the mRNA . Each anticodon specifies an amino acid.
The amino acids are bonded together as peptide chains…which fold into proteins
Translation

3. The Genetic Code: 3 letters = 1 codon  1 amino acid

5. “Charging”  addition of specific amino acid to its tRNA
Review tRNA structure
“Charging”  addition of specific amino acid to its tRNA
20 different enzymes are involved
Requires energy to bind amino acid to tRNA

7. Ribosome Structure

8. Three stages: Initiation Elongation Termination

9. Translation initiation complex
The initiation stage of translation
Brings together mRNA, tRNA bearing the first amino acid of the polypeptide, and two subunits of a ribosome
Large
ribosomal
subunit
The arrival of a large ribosomal subunit completes
the initiation complex. Proteins called initiation
factors (not shown) are required to bring all the
translation components together. GTP provides
the energy for the assembly. The initiator tRNA is
in the P site; the A site is available to the tRNA
bearing the next amino acid. 2
Initiator tRNA
mRNA
mRNA binding site
Small
Translation initiation complex
P site
GDP
GTP
Start codon
A small ribosomal subunit binds to a molecule of
mRNA. In a prokaryotic cell, the mRNA binding site
on this subunit recognizes a specific nucleotide
sequence on the mRNA just upstream of the start
codon. An initiator tRNA, with the anticodon UAC,
base-pairs with the start codon, AUG. This tRNA
carries the amino acid methionine (Met). 1
Met U A C G E 3 5
Figure 17.17

10. Elongation
Amino acids are added one by one to the preceding amino acid
Figure 17.18
Amino end
of polypeptide
mRNA
Ribosome ready for
next aminoacyl tRNA E P A
GDP
GTP 2
site 5 3
TRANSCRIPTION
TRANSLATION
DNA
Ribosome
Polypeptide
Codon recognition. The anticodon
of an incoming aminoacyl tRNA
base-pairs with the complementary
mRNA codon in the A site. Hydrolysis
of GTP increases the accuracy and
efficiency of this step. 1
Peptide bond formation. An
rRNA molecule of the large
subunit catalyzes the formation
of a peptide bond between the
new amino acid in the A site and
the carboxyl end of the growing
polypeptide in the P site. This step
attaches the polypeptide to the
tRNA in the A site. 2
Translocation. The ribosome
translocates the tRNA in the A
site to the P site. The empty tRNA
in the P site is moved to the E site,
where it is released. The mRNA
moves along with its bound tRNAs,
bringing the next codon to be
translated into the A site. 3

11. Termination Ribosome reaches a stop codon in the mRNA Figure 17.19
Release
factor
Free
polypeptide
Stop codon
(UAG, UAA, or UGA) 5 3
When a ribosome reaches a stop
codon on mRNA, the A site of the
ribosome accepts a protein called
a release factor instead of tRNA. 1
The release factor hydrolyzes
the bond between the tRNA in
the P site and the last amino
acid of the polypeptide chain.
The polypeptide is thus freed
from the ribosome. 2 3
The two ribosomal subunits
and the other components of
the assembly dissociate.

12. Practice with this sequence
DNA: 5’TCGATGTTCCGCCGTACGTCGTAACCG
3’AGCTACAAGGCGGCATGCAGCATTGGC
Use the bottom strand as the complement to the mRNA.  sense strand (versus antisense strand)
Hint: Look for where it starts. How do you know?
Once you’ve found the “reading frame”, write in triplets
mRNA 
Use your genetic code wheel to write the amino acid sequence. How will you know when to stop?

13. Try again without help DNA: 5’CGTCATGTTCGCGCTACAAATGAAATGA
3’GCAGTACAAGCGCGATGTTTACTTTACT
mRNA:
Polypeptide:

14. 9.6 Transport and Modification of Proteins
The amino acid sequence is only the primary structure of the protein
Many proteins still need to be chemically modified and folded, some may need to be cut into segments or have parts removed
Transport
Proteins meant to function outside of the cell or in the membrane are assembled at the ribosomes on the ER (Why?)
A region in the sequence of the protein called signal sequence helps direct the protein
Chaperones  “helper” proteins for processes

16. Protein Folding Amino acids have different properties
Some are positively charged, some are negatively charged, some are hydrophilic, hydrophobic or neutral.
This affects their interaction within themselves
Takahashi and Miller (UCLA, 2007)
Used this information to create a musical interpretation of the amino acids
Huntington gene

17. 9.7 Translation Errors Most mistakes are caught and corrected
Mistakes that can occur:
Frameshifts (reading frame is shifted by 1 or 2 nucleotides
Can cause wrong AA sequence
Can cause early STOP
Insufficient supply of needed amino acids

18. Effects of Mutations in DNA to Protein Synthesis
Insertion (cause frameshift)
Nucleotide(s) added to sequence
Deletion (cause frameshift)
Nucleotide(s) skipped in sequence
Substitution (usually just alters 1 AA)
Correct nucleotide is replaced with incorrect nucleotide

19. Example of Deletion and Insertion Mutations

20. Mutations continued…. Sequence Mutations  one or a few bp change
Substitutions, deletions, insertaions
Point Mutations
Missense  change an important a.a.
Nonsense  change an a.a. to a stop codon
Frameshift Mutations
Chromosomal Mutations  larger scale
Deletions, duplications, inversions, translocations
See handout for more details