Download presentation
Presentation is loading. Please wait.
1
Chapter 17 – From Gene to Protein
2
One Gene – One Enzyme Beadle and Tatum (1930s)
Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium Created 3 classes of mutants which grew with different media Deduced each mutant was unable to carry out one step of the arginine pathway Revised theory to One Gene – One Polypeptide (many enzymes are made up of multiple polypeptide chains.
3
Protein Synthesis: Overview
Transcription: Synthesis of RNA under the direction of DNA (mRNA) Occurs in the nucleus (of eukaryotes) Translation: Actual synthesis of a polypeptide under the direction of mRNA Occurs in ribosomes In eukaryotes – mRNA must be processed before translation can proceed
4
Protein Synthesis Challenge
Determine the amino acid sequence for the following DNA template: TACCCTGCGTTAAGCTACCCAATT
5
The Triplet Code The genetic instructions for a polypeptide chain are ‘written’ in the DNA as a series of nucleotides called a codon ‘U’ (uracil) replaces ‘T’ in RNA
6
Genetic Code Each codon encodes for one amino acid
AUG = start codon or methionine 3 stop codons = UAA, UAG, UGA
7
Transcription Unit and Terms
RNA polymerase: pries DNA apart and hooks RNA nucleotides together from the DNA code Promoter region on DNA: where RNA polymerase attaches and where initiation of RNA begins Terminator region: sequence that signals the end of transcription Transcription unit: stretch of DNA transcribed into an RNA molecule
8
Transcription: Overview
Initiation – after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis on the template strand Elongation – the polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5’ to 3’ Termination – RNA transcript is released, polymerase detaches, DNA completely reseals
9
Transcription: Initiation
Eukaryotic promoter region contains a TATA box, about 25 nucleotides upstream of start point Transcription factors bind to TATA box, must occur before RNA polymerase II can attach RNA polymerase II and additional transcription factors attach forming the initiation complex Unwinds the DNA and RNA synthesis begins
10
Transcription: Elongation and Termination
Untwists DNA double helix, exposing 10 to 20 nucleotides Adds nucleotides to growing 3’ end Termination: Transcription terminates when polymerase falls off (not exactly understood how in eukaryotes)
11
Transcription: Review
Transcription animation
12
Eukaryotic pre-mRNA structure
5’ cap – modified guanine nucleotides, thought to function in protecting the reading sequence of DNA, facilitate movement of the mRNA out of the nucleus and aids in ribosome attachment 3’ poly-A tail – adenine molecules, similar functions as 5’ cap, protection, recognition, transport mRNA processing animation
13
Eukaryotic mRNA Modification
Exons – coding Introns – non-coding Must remove the introns from the pre-mRNA to create the mRNA transcript snRNPs and proteins form spliceosome Attaches at specific locations on pre-mRNA RNA transcript is cut, introns removed, exons spliced together animation
14
Evolutionary Significance
So what is the biological function of an intron? Some introns control gene activity in some way Some introns may be exons, alternative RNA splicing Multiple domains in one gene Could lead to evolution of new exons (exon shuffling)
15
Translation: basic concept
mRNA is moved through a ribosome Codons are translated into an amino acid sequence, one by one tRNA molecules bring the amino acids to the ribosomes Creation of a polypeptide chain
16
tRNA Structure Carry amino acids to the ribosomes for translation
Anticodon 3’ AA attachment site
17
tRNA Production Aminoacyl-tRNA synthetase binds an amino acid to its specific tRNA molecule When attached called an aminoacyl-tRNA 20 different synthetases, one for each amino acid 45 different tRNA molecules, but 61 different RNA codons, how is this possible? 3rd base in anticodon can bond to multiple codons For example, U can pair with both A and G in 3rd position of tRNA, also some tRNA have inosine (a purine) in the 3rd position which can pair with A, U, or C
18
Ribosome Structure Composed of rRNA and protein
Each ribosome has 2 subunits, small and large Small subunit has mRNA binding site Large subunit has 3 tRNA binding sites: P (peptidyl-tRNA site), A (aminoacyl-tRNA site), and E (exit site).
19
Translation: Initiation
mRNA binds to small ribosomal subunit Initiator tRNA attaches to the start codon AUG Large subunit attaches with initiator tRNA in p site, uses energy in GTP
20
Translation: Elongation
21
Translation: Elongation
The anticodon of an incoming aminoacyl-tRNA base-pairs with the complementary mRNA codon in the A-site Large subunit catalyzes the formation of a peptide bond between the amino acids attached to the tRNA in both the P and A sites The growing polypeptide chain is transferred to the tRNA in the A site The ribosome translocates, moving the “naked” tRNA to the E site for removal, exposing the A site for the next tRNA
22
Translation: Termination
When ribosome reaches stop codon, ribosome accepts a release factor protein Hydrolyzes the bond between the tRNA in the P site and the last amino acid in the chain The 2 subunits and other components dissociate
23
Translation: Review Translation animation
24
Polyribosomes (or polysomes)
Takes approximately a minute to make an average size polypeptide chain Can have multiple ribosomes on the same mRNA chain Enable cell to make many copies of a protein very quickly
25
Gene Expression Overview
26
Polypeptides and the ER
Proteins destined for export need to be moved through the endomembrane system Growing polypeptide chain (in cytosol) will have a signal peptide sequence Signal recognition particle (SRP) guides ribosome to ER
27
Point Mutations Mutations are changes in the genetic material of a cell Point mutations are changes in just one base pair Can cause genetic disorders, ex. Sickle cell
28
Types of Point Mutations
Base-pair substitution – the replacement of one nucleotide for another Silent – no effect Missense – still codes for an amino acid, but the wrong one Nonsense – stop codon, premature termination
29
Other Types of Mutations
Insertions and deletions – additions and losses of nucleotide pairs in a gene, usually more of a problem than substitutions Frameshift mutations – when the number of nucleotides inserted or deleted is not a multiple of 3, shifts the codon reading frame, can either be missense or nonsense Mutagen – chemical or physical agent that causes a mutation
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.