1. Chapter 17 – From Gene to Protein

2. One Gene – One Enzyme Beadle and Tatum (1930s)
Bombarded Neurospora (bread mold) with radiation to create mutants that could grow on different types of nutritional medium
Created 3 classes of mutants which grew with different media
Deduced each mutant was unable to carry out one step of the arginine pathway
Revised theory to One Gene – One Polypeptide (many enzymes are made up of multiple polypeptide chains.

3. Protein Synthesis: Overview
Transcription:
Synthesis of RNA under the direction of DNA (mRNA)
Occurs in the nucleus (of eukaryotes)
Translation:
Actual synthesis of a polypeptide under the direction of mRNA
Occurs in ribosomes
In eukaryotes – mRNA must be processed before translation can proceed

4. Protein Synthesis Challenge
Determine the amino acid sequence for the following DNA template:
TACCCTGCGTTAAGCTACCCAATT

5. The Triplet Code
The genetic instructions for a polypeptide chain are ‘written’ in the DNA as a series of nucleotides called a codon
‘U’ (uracil) replaces ‘T’ in RNA

6. Genetic Code Each codon encodes for one amino acid
AUG = start codon or methionine
3 stop codons = UAA, UAG, UGA

7. Transcription Unit and Terms
RNA polymerase: pries DNA apart and hooks RNA nucleotides together from the DNA code
Promoter region on DNA: where RNA polymerase attaches and where initiation of RNA begins
Terminator region: sequence that signals the end of transcription
Transcription unit: stretch of DNA transcribed into an RNA molecule

8. Transcription: Overview
Initiation – after RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis on the template strand
Elongation – the polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5’ to 3’
Termination – RNA transcript is released, polymerase detaches, DNA completely reseals

9. Transcription: Initiation
Eukaryotic promoter region contains a TATA box, about 25 nucleotides upstream of start point
Transcription factors bind to TATA box, must occur before RNA polymerase II can attach
RNA polymerase II and additional transcription factors attach forming the initiation complex
Unwinds the DNA and RNA synthesis begins

10. Transcription: Elongation and Termination
Untwists DNA double helix, exposing 10 to 20 nucleotides
Adds nucleotides to growing 3’ end
Termination:
Transcription terminates when polymerase falls off (not exactly understood how in eukaryotes)

11. Transcription: Review
Transcription animation

12. Eukaryotic pre-mRNA structure
5’ cap – modified guanine nucleotides, thought to function in protecting the reading sequence of DNA, facilitate movement of the mRNA out of the nucleus and aids in ribosome attachment
3’ poly-A tail – adenine molecules, similar functions as 5’ cap, protection, recognition, transport
mRNA processing animation

13. Eukaryotic mRNA Modification
Exons – coding
Introns – non-coding
Must remove the introns from the pre-mRNA to create the mRNA transcript
snRNPs and proteins form spliceosome
Attaches at specific locations on pre-mRNA
RNA transcript is cut, introns removed, exons spliced together
animation

14. Evolutionary Significance
So what is the biological function of an intron?
Some introns control gene activity in some way
Some introns may be exons, alternative RNA splicing
Multiple domains in one gene
Could lead to evolution of new exons (exon shuffling)

15. Translation: basic concept
mRNA is moved through a ribosome
Codons are translated into an amino acid sequence, one by one
tRNA molecules bring the amino acids to the ribosomes
Creation of a polypeptide chain

16. tRNA Structure Carry amino acids to the ribosomes for translation
Anticodon
3’ AA attachment site

17. tRNA Production
Aminoacyl-tRNA synthetase binds an amino acid to its specific tRNA molecule
When attached called an aminoacyl-tRNA
20 different synthetases, one for each amino acid
45 different tRNA molecules, but 61 different RNA codons, how is this possible?
3rd base in anticodon can bond to multiple codons
For example, U can pair with both A and G in 3rd position of tRNA, also some tRNA have inosine (a purine) in the 3rd position which can pair with A, U, or C

18. Ribosome Structure Composed of rRNA and protein
Each ribosome has 2 subunits, small and large
Small subunit has mRNA binding site
Large subunit has 3 tRNA binding sites: P (peptidyl-tRNA site), A (aminoacyl-tRNA site), and E (exit site).

19. Translation: Initiation
mRNA binds to small ribosomal subunit
Initiator tRNA attaches to the start codon AUG
Large subunit attaches with initiator tRNA in p site, uses energy in GTP

20. Translation: Elongation

21. Translation: Elongation
The anticodon of an incoming aminoacyl-tRNA base-pairs with the complementary mRNA codon in the A-site
Large subunit catalyzes the formation of a peptide bond between the amino acids attached to the tRNA in both the P and A sites
The growing polypeptide chain is transferred to the tRNA in the A site
The ribosome translocates, moving the “naked” tRNA to the E site for removal, exposing the A site for the next tRNA

22. Translation: Termination
When ribosome reaches stop codon, ribosome accepts a release factor protein
Hydrolyzes the bond between the tRNA in the P site and the last amino acid in the chain
The 2 subunits and other components dissociate

23. Translation: Review
Translation animation

24. Polyribosomes (or polysomes)
Takes approximately a minute to make an average size polypeptide chain
Can have multiple ribosomes on the same mRNA chain
Enable cell to make many copies of a protein very quickly

25. Gene Expression Overview

26. Polypeptides and the ER
Proteins destined for export need to be moved through the endomembrane system
Growing polypeptide chain (in cytosol) will have a signal peptide sequence
Signal recognition particle (SRP) guides ribosome to ER

27. Point Mutations
Mutations are changes in the genetic material of a cell
Point mutations are changes in just one base pair
Can cause genetic disorders, ex. Sickle cell

28. Types of Point Mutations
Base-pair substitution – the replacement of one nucleotide for another
Silent – no effect
Missense – still codes for an amino acid, but the wrong one
Nonsense – stop codon, premature termination

29. Other Types of Mutations
Insertions and deletions – additions and losses of nucleotide pairs in a gene, usually more of a problem than substitutions
Frameshift mutations – when the number of nucleotides inserted or deleted is not a multiple of 3, shifts the codon reading frame, can either be missense or nonsense
Mutagen – chemical or physical agent that causes a mutation