Presentation is loading. Please wait.

Presentation is loading. Please wait.

From gene to protein DNA mRNA protein trait nucleus cytoplasm

Similar presentations


Presentation on theme: "From gene to protein DNA mRNA protein trait nucleus cytoplasm"— Presentation transcript:

1 From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

2 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

3 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

4 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

5 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AUG methionine Stop codons UGA, UAA, UAG

6 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

7 From gene to protein DNA mRNA protein trait nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

8 Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

9 Can you tell the story? RNA polymerase DNA amino acids exon intron
tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome


Download ppt "From gene to protein DNA mRNA protein trait nucleus cytoplasm"

Similar presentations


Ads by Google