Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

RNA and Protein Synthesis

RNA Transcription.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis.

FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.

The Structure of RNA RiboNucleic Acid

Lesson Overview 13.1 RNA.

Protein Synthesis: Transcription

Protein Synthesis Step 2: Translation. Review Protein Synthesis: The process by which the message of DNA is used to make proteins Step 1: Transcription.

Transcription and Translation

DNA, RNA, & Protein Synthesis (12.3) State Standards 2A. Distinguish between DNA and RNA. 2B. Explain the role of DNA in storing and transmitting cellular.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

Section 11-2 From DNA to Proteins.  Enzymes control all the chemical reactions of an organism  Thus, by encoding the instructions form making proteins,

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA & Protein Synthesis.

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.

B IOLOGY : T HURSDAY, J ANUARY 10 TH Today’s Tasks: DNA Replication Review Transcription Notes Round Robin Practice Remember to turn in you nucleic acids.

8.4 Transcription KEY CONCEPT – DNA directs the synthesis of proteins through three steps (Replication, Transcription, & Translation) Transcription is.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA and Protein Synthesis

3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.

RNARNA. PROTEIN SYNTHESIS The BIG Picture……. Objective: By the end of class today students will be able to change a DNA sequence into an PROTIEN sequence.

12-3 RNA and Protein Synthesis

DNA, mRNA, and Protein Synthesis TAKS Review for April 22 test.

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message.

What is central dogma? From DNA to Protein

DNA to Protein The processes of DNA transcription and translation.

Chapter 13 –RNA and Protein Synthesis

Transcription, Translation & Protein Synthesis. Protein Synthesis Protein synthesis - a cell makes protein based on the message contained within its DNA.

Structure of DNA DNA is made up of a long chain of nucleotides

DNA Replication Review Three main steps: Helicase unzips/unwinds the DNA molecule DNA Polymerase brings in new nucleotides Ligase zips the new DNA back.

Objective Explain the function and structure of RNA. Determine how transcription produces a RNA copy of DNA. Analyze the purpose of transcription.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule. NEW VOCABULARY (Def. on next 2 slides) Central Dogma RNA.

From DNA to RNA Biology. Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino.

DNA Deoxyribose Nucleic Acid – is the information code to make an organism and controls the activities of the cell. –Mitosis copies this code so that all.

Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.

Step One: Transcription

Cell Controls How does a cell control its processes?

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.

What is the ultimate job of the cell?. TO MAKE PROTEINS!

Protein Synthesis Notes. Main Idea DNA codes for RNA, which guides protein synthesis. Protein Synthesis is the making of proteins.

Molecules to Eye Color DNA, RNA and Protein Synthesis.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.

Notes: Transcription DNA vs. RNA

Transcription, Translation & Protein Synthesis

12.3 KEY CONCEPT Transcription converts DNA into a single-stranded RNA molecule. DNA can not leave nucleus..RNA CAN!

Protein Synthesis.

Protein Synthesis.

From DNA to Proteins Transcription.

Notes over Active Transport and Protein Synthesis

Protein Synthesis.

Protein Synthesis.

Notes – Protein Synthesis: Transcription

RNA and Transcription DNA RNA PROTEIN.

Protein Synthesis Part 1

Transcription/ Translation Notes 16-17

RNA is a nucleic acid made of linked nucleotides.

RNA: another nucleic acid

Transcription & Translation

Protein Synthesis.

Protein Synthesis.

Presentation transcript:

Transcription, Translation & Protein Synthesis

Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm.

Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mRNA – carries a message from the DNA to the ribosome 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.

Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not double- stranded

Ribonucleic Acids (RNA)

Protein Synthesis Occurs in TWO steps: 1. Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

The Central Dogma This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N

Step One: Transcription 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different?? 3. New backbone formed: The sugar- phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

Step One: Transcription Watch this simplified animation: Transcription Animation

Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

Step 1½: RNA Editing An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. interon exon An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.

Step 1½: RNA Editing DNA exon 1 interon exon 2 interon exon 3 pre-RNA (in nucleus) exon 1exon 2exon 3 RNA (in cytoplasm) transcription interon RNA editing

Step Two: Translation Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence?

Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. pheilevalproalahisasnaspcysarg leumetserthrtyrglnlysglutrpgly A T C G

Step Two: Translation Watch this simplified animation: Translation Animation

Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

The Genetic Code

Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

The Genetic Code

Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser

The Genetic Code

Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser

RECAP: 1. DNA is transcribed into mRNA in the nucleus. 2. The mRNA leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mRNA sequence using tRNA and amino acids.