1. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Transcription, Translation & Protein Synthesis

2. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein  There are 20 types of amino acids, some  we can make, and some we can’t  There are infinite combinations of amino  acids  Can be hundreds or thousands monomers Long These long chains are called polypeptide chains

3. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis  Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA.  However: – DNA is only found in the nucleus – Proteins are only made outside the nucleus – in the cytoplasm.  Houston, we have a problem.

4. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis  How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus?  A molecular cousin of DNA – RNA – is used to carry these messages.

5. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA)  The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm).  There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.

6. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA)  RNA is almost exactly like DNA, except: – Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) – Contains uracil instead of thymine. – RNA is single-stranded, not double-stranded (usually…)

7. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA)

8. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis  Occurs in TWO steps:  Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA  Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

9. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Central Dogma  This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N

10. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription  DNA unzips: enzymes split apart base pairs and unwind the DNA double helix.  Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different??  New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

11. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription  Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/transcription.swf  Watch the more complex animation!  http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a2.html http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a2.html

12. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription  Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

13. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription  Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

14. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing  An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. interon exon  An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon.

15. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing DNA exon 1 interon exon 2 interon exon 3 pre-RNA (in nucleus) exon 1exon 2exon 3 RNA (in cytoplasm) transcription interon RNA editing

16. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation “ Step Two: Translation “to decode or decipher the meaning of”  Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence.  How does the mRNA sequence translate into an amino acid sequence?

17. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Problem: – There are 20 different amino acids. – There are 4 RNA bases. pheilevalproalahisasnaspcysarg leumetserthrtyrglnlysglutrpgly A T C G

18. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/translation.swf  Watch the more complex animation!  http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a3.html http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a3.html

19. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  So how do you exactly go about determining what protein your cells are going to make?  FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

20. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

21. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code

22. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

23. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code

24. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser

25. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code

26. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser

27. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL RECAP:  DNA is transcribed into mRNA in the nucleus.  The mRNA leaves the nucleus and enters the cytoplasm.  The protein is translated from the mRNA sequence using tRNA and amino acids.