2. Transcription, Translation & Protein Synthesis

3. Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein  There are 20 types of amino acids, some  we can make, and some we can’t  There are infinite combinations of amino  acids  Can be hundreds or thousands monomers Long These long chains are called polypeptide chains

4. Protein Synthesis  Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA.  However: – DNA is only found in the nucleus – Proteins are only made outside the nucleus – in the cytoplasm.  Houston, we have a problem.

5. Protein Synthesis  How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus?  A molecular cousin of DNA – RNA – is used to carry these messages.

6. Ribonucleic Acids (RNA)  The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm).  There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.

7. Ribonucleic Acids (RNA)  RNA is almost exactly like DNA, except: – Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) – Contains uracil instead of thymine. – RNA is single-stranded, not double- stranded (usually…)

8. Ribonucleic Acids (RNA)

9. Protein Synthesis  Occurs in TWO steps:  Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA  Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

10. The Central Dogma  This order of events is called the central dogma of molecular biology: DNARNA P R O T E I N

11. Step One: Transcription  DNA unzips: enzymes split apart base pairs and unwind the DNA double helix.  Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different??  New backbone formed: The sugar- phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

12. Step One: Transcription  Watch this simplified animation: http://www.stolaf.edu/people/giannini/flash animat/molgenetics/transcription.swf  Watch the more complex animation!  http://www- class.unl.edu/biochem/gp2/m_biology/a nimation/gene/gene_a2.html http://www- class.unl.edu/biochem/gp2/m_biology/a nimation/gene/gene_a2.html

13. Step One: Transcription  Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

14. Step One: Transcription  Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

15. Step 1½: RNA Editing  An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. intron exon  An mRNA sequence that does NOT code for protein is called an intron. A sequence that is useful in making a protein is called an exon.

16. Step 1½: RNA Editing DNA exon 1 intron exon 2 intron exon 3 pre-RNA (in nucleus) exon 1exon 2exon 3 RNA (in cytoplasm) transcription intron RNA editing

17. Step Two: Translation “ Step Two: Translation “to decode or decipher the meaning of”  Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence.  How does the mRNA sequence translate into an amino acid sequence?

18. Step Two: Translation  Problem: – There are 20 different amino acids. – There are 4 RNA bases. pheilevalproalahisasnaspcysarg leumetserthrtyrglnlysglutrpgly A T C G

19. Step Two: Translation  Watch this simplified animation: http://www.stolaf.edu/people/giannini/flash animat/molgenetics/translation.swf  Watch the more complex animation!  http://www- class.unl.edu/biochem/gp2/m_biology/a nimation/gene/gene_a3.html http://www- class.unl.edu/biochem/gp2/m_biology/a nimation/gene/gene_a3.html

20. A U G G G C U U A A A G C A G U G C A C G U U This is a molecule of messenger RNA. It was made in the nucleus by transcription from a DNA molecule. mRNA molecule codon

21. A U G G G C U U A A A G C A G U G C A C G U U A ribosome on the rough endoplasmic reticulum attaches to the mRNA molecule. ribosome

22. A U G G G C U U A A A G C A G U G C A C G U U It brings an amino acid to the first three bases (codon) on the mRNA. Amino acid tRNA molecule anticodon U A C A transfer RNA molecule arrives. The three unpaired bases (anticodon) on the tRNA link up with the codon.

23. A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule comes into place, bringing a second amino acid. U A C C C G Its anticodon links up with the second codon on the mRNA.

24. A U G G G C U U A A A G C A G U G C A C G U U A peptide bond forms between the two amino acids. Peptide bond C C G U A C

25. A U G G G C U U A A A G C A G U G C A C G U U The first tRNA molecule releases its amino acid and moves off into the cytoplasm. C C G U A C

26. A U G G G C U U A A A G C A G U G C A C G U U C C G The ribosome moves along the mRNA to the next codon.

27. A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule brings the next amino acid into place. C C G A A U

28. A U G G G C U U A A A G C A G U G C A C G U U A peptide bond joins the second and third amino acids to form a polypeptide chain. C C G

29. A U G G G C U U A A A G C A G U G C A C G U U The polypeptide chain gets longer. G U C A C G The process continues. The polypeptide is then complete. This continues until a termination (stop) codon is reached.

30. Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?

31. The Genetic Code

33. Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA asp???argthraspargser

34. The Genetic Code

35. Step Two: Translation  Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: met AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA aspSTOPmetthraspargser

36. RECAP:  DNA is transcribed into mRNA in the nucleus.  The mRNA leaves the nucleus and enters the cytoplasm.  The protein is translated from the mRNA sequence using tRNA and amino acids.