Monday 3/14/2016 LT: Today I will… – Compare and Contrast DNA and RNA – Investigate transcription and translation ET: Open your books to the chapter on protein synthesis… – What are the 3 important differences between RNA and DNA

Tuesday 3/15/2016 _ Daily Objective: Describe and summarize the processes of transcription and translation Entrance Task: What is transcription? What is translation?

What does DNA do? Instructions – Control the production of proteins DNARNAProtein Transcription Translation

Ribonucleic Acid vs. Deoxyribonucleic Acid DNA Deoxyribose Sugar Double Stranded Thymine RNA Ribose Sugar Single Stranded Uracil ATTGCGGTTAAATTGCGGTTAA TAACGCCAATTTAACGCCAATT AUUGCGGUUAAAUUGCGGUUAA DNA RNA

Types of RNA mRNA – messenger RNA takes the message from the DNA to the ribosome to be translated into a protein rRNA – ribosomal RNA is part of the ribosome that translates the protein tRNA – transfer RNA transfers amino acids to the ribosome as it is specified by the 3 base pair sequence (codon) from the mRNA PROTEIN SYNTHESIS!!

TRANSCRIPTION: Part of the nucleotide sequence DNA is copied into an RNA sequence. – DNA unzipped by RNA Polymerase – One strand of DNA is used as a template to make RNA strands Transcription

Promoters are regions of the DNA sequence that tell RNA polymerase where to bind and start transcription. The base sequence at those “promoter” regions signal the enzyme where to bind Transcription How does the RNA polymerase enzyme know where to start?

Lets practice transcribing mRNA Use the following DNA Templates to transcribe the mRNA strands – DNA: ATG TTC GCG CGT – DNA:GCA TGC CTA CCG – DNA:AGA CGT ATA GAT

Lets practice DNA codon:ATC mRNA codon:UAG tRNA anticodon: AUC RNA i

Translation of mRNA LT: Today I will… – Use the order of nitrogenous bases in mRNA to create a protein polymer of amino acids ET: Transcribe the following DNA into an mRNA sequence. DNA - A A T C G A T G C C RNA -

Translation Where: Ribosome What: it takes the mRNA information and builds a protein Who: 3 base pairs make a codon = the code for an amino acid – tRNA brings the an amino acid that has the compliment to mRNA = Anticodon Ex. If the mRNA codon in the ribosome is AUG – tRNA brings UAC to the ribosome. AUG is the code for an amino acid Q: What do you notice about the tRNA anticodon? What does it look like?

PROTEINS What monomers make up the polymer protein? – AMINO ACIDS!! Different combinations of amino acids make up different proteins Q: How can the order of nitrogenous bases in DNA and RNA be translated into amino acids?

Translation mRNA contains 4 different nitrogenous bases: A, U, C, and G Combinations of 3 of these bases code for one particular amino acid These combinations are called CODONS

What amino acid would form from the following codons? GUC=___________ UGG=___________ CAG=___________ CAA=___________ UUU=___________

Steps of Translation 1.mRNA is transcribed from DNA in the nucleus and sent into the cytoplasm 2.mRNA attaches to a ribosome. 3.Codons pass through the ribosome and the correct amino acids are brought in by tRNA creating a polypeptide chain

Steps of Translation 4.The ribosome forms peptide bonds between the amino acids. 5.The chain continues until the ribosome reaches a stop codon and releases the protein

Translation

Mutations LT: Today I will… – Define mutations and describe the different types of mutations ET: Quiz! Take out a half sheet of paper and write your name at the top. *you will need a translation chart from your book or on the pink card.

Quiz DNA Gene Sequence:TAC GCA TAC ATT Transcribe the RNA: Write the Anti codons: Translate the mRNA Codons:

What kind of problems could arise if one nucleotide in a DNA sequence is transcribed incorrectly? GGCGCGGTTAAGGGCGCGGTTAAG CCGCGCCAAUUCCCGCGCCAAUUC GGCGCGGTTAAGGGCGCGGTTAAG CCGCGCUAAUUCCCGCGCUAAUUC Proline Arginine Glutamine Proline Arginine STOP

2 types of Mutations 1.Gene mutations – Substitution – Insertion – deletion 2.Chromosomal mutations – Deletion – Duplication – Inversion – translocation

Gene Mutation Mutations that occur only to a single gene on the chromosome – Frameshift (they shift the segment that is being read) Ex. Insertions and deletions – Point: only one or a few base pairs are changed Ex. Substitution

Chromosomal Mutations Changes part of the chromosome which may disrupt many genes on the chromosome

What are Mutagens? Chemical or physical agents in the environment that cause mutations