Gene Expression How do genotypes become phenotypes? 23 from mom 23 from dad

Chromosome: –Structure found in the nucleus of all* cells –Made of DNA coiled around histone proteins, compacted DNA: –Double helix shape –Stores genetic “gene” information –Self-replicates to produce 2 exact copies of itself Gene: –A segment of DNA that serves as a code for a specific phenotype Gene for Type A Blood

GenotypePhenotype inherit Propose how this occurs. What other factors might be included “within” the blue arrow? How do you go from alleles (A, a) to an actual phenotype that is noticeable?

DeoxyriboNucleic Acid Antiparallel strands (gene is 5’  3’) Monomers = nucleotides Adenine, Thymine, Cytosine, Guanine 1 nucleotide = 3 parts –Deoxyribose sugar –Phosphate –Base Uses complimentary base pairing rules A  T and C  G 5’ CGTGGTTAAATCT 3’

The Central Dogma of Biology DNA RNA Protein

Transcription Translation The Central Dogma Replication

DNA Replication DNA is copied accurately to preserve an organism’s genotype Occurs before cell division so each chromosome has 2 copies to give –meiosis (cell division for gametes) –mitosis (cell division for growth) Takes place in the nucleus Enzymes used in process: –Helicase - Unwinds double helix –DNA Polymerase - Creates new strand

DNA Replication New DNA strands are formed based off original DNA sequence

DNA Replication 5’ CGTGGTTAAATCT 3’ GCACCAATTTAGA “Template Strand” 3’  5’ GAGTCCTGTCATAAAATG 3’ CTCAGGACAGTATTTTAC 5’ Let’s model DNA Replication! “Gene” 5’  3’

What’s next? After DNA Replication, there is enough DNA make 2 new cells… and then again, and again until the organism stops performing cell division (i.e., never, really). Once a new cell is made, it can begin to use the DNA to create phenotypes. We call this next part Gene Expression, or the production of a phenotype given information from the genotype (“gene” = segments of DNA) and it can be divided into 2 steps: Transcription and Translation.

Transcription Produces a RiboNucleic Acid (single) strand using a DNA template DNA is “read” from 3’  5’ (“template” strand) Transcription enzyme = RNA Polymerase Takes place in the nucleus In gene expression, mRNA is made Base pair rules: C  G G  C T  A A  U

Let’s Transcribe! Gene 5’ TCATGCAGAGGAGATTAA 3’ Template 3’ AGTACGTCTCCTCTAATT 5’ mRNA 5’ 3’ Gene 5’ GATCAGGGAGACTTAGCA 3’ Template 3’ CTAGTCCCTCTGAATCGT 5’ mRNA 5’ 3’

Translation Produces an amino acid sequence using mRNA as a template mRNA is “read” from 5’  3’ in triplets (“codons”) Codons code for amino acids Start codon is AUG but stop codon varies Enzyme* that does this is called tRNA Takes place in cytoplasm at a ribosome After folding of polypeptide, a protein is formed!

The Genetic Code Examples: AUG is Met (start) ACC is Thr AGA is Arg! UAA is Stop UAG is Stop UGA is Stop

Use the Genetic Code to figure out what amino acids are assembled based on mRNA strand Alanine Threonine Glutamate Leucine Arginine Serine Stop!

Translation Gene 5’ GATCATGCGTCTCCTCTAATT 3’ Template mRNA Amino Acids

Translation Gene 5’ 3’ Template 3’ CTCATACGGACAGTATTTTAC 5’ mRNA Amino Acids

Once the amino acid sequence is complete, it folds into a 3D “glob” = a protein! Proteins do all of our cellular work, so they create phenotypes. Discuss with a neighbor: How do you get from genotype to phenotype?

Your Task Gene Expression Practice Worksheet Compare to key when finished to see if you have the skills! Homework due Friday Snorks

Discuss with your neighbors: 1.Where does DNA Replication take place? 2.Where does Transcription take place? 3.What does Transcription produce? 4.Where does Translation take place? 5.What does Translation produce? 6.The Genetic Code is used to figure out what amino acids are assembled based on the strand created from the strand

What is the deal with 5’ and 3’?