Presentation is loading. Please wait.

Presentation is loading. Please wait.

HAPPY MONDAY 3/13 Review for Inheritance Test tomorrow!

Similar presentations


Presentation on theme: "HAPPY MONDAY 3/13 Review for Inheritance Test tomorrow!"— Presentation transcript:

1 HAPPY MONDAY 3/13 Review for Inheritance Test tomorrow!
Study session after school Study guide answers will be 6:00pm tonight Don’t forget: Trihybrid Extra Credit and Karyotype Extra Credit due tomorrow as well

2 HAPPY TUESDAY 3/14 Turn in any Extra Credit to green box
Clear desks for Inheritance Test Extra Credit last 10 minutes of class Turn in test to green box when finished

3 HAPPY WEDNESDAY 3/15 Give your brains a rest!
DNA structure coloring sheet and analysis questions Answer the analysis questions in your notebook or on the back of the worksheet Textbook reading over the storing of genetic information and the structure and replication of DNA Due this FRIDAY, March 17 Friendly reminder: I will also be stamping Pedigree Analysis Packet and Meiosis Review sheet FRIDAY

4 HAPPY THURSDAY 3/16 Take out notebook and prepare for “Gene Expression Lecture Day 1” Reminder: I will be checking DNA coloring sheet/DNA Structure and Replication reading guides x2 tomorrow (Friday 3/17) Also checking “Pedigree Analysis” and “Meiosis Review”

5 Gene Expression How do genotypes become phenotypes?
23 from dad 23 from mom

6 Chromosome: DNA: Gene: Structure found in the nucleus of all* cells
Made of DNA coiled around histone proteins, compacted DNA: Double helix shape Stores genetic “gene” information Self-replicates to produce 2 exact copies of itself Gene: A segment of DNA that serves as a code for a specific phenotype Gene for Type A Blood

7 Genotype Phenotype inherit
Propose how this occurs. What other factors might be included “within” the blue arrow? How do you go from alleles (A, a) to an actual phenotype that is noticeable?

8 DeoxyriboNucleic Acid
Antiparallel strands (gene is 5’ 3’) Monomers = nucleotides Adenine, Thymine, Cytosine, Guanine 1 nucleotide = 3 parts Deoxyribose sugar Phosphate Base Uses complimentary base pairing rules A  T and C  G 5’ CGTGGTTAAATCT 3’

9 The Central Dogma of Biology
DNA RNA Protein

10 The Central Dogma DNA RNA Protein Transcription Translation
Replication Transcription Translation DNA RNA Protein

11 DNA Replication DNA is copied accurately to preserve an organism’s genotype Occurs before cell division so each chromosome has 2 copies to give meiosis (cell division for gametes) mitosis (cell division for growth) Takes place in the nucleus Enzymes used in process: Helicase - Unwinds double helix DNA Polymerase - Creates new strand

12 New DNA strands are formed based off original DNA sequence
DNA Replication New DNA strands are formed based off original DNA sequence

13 DNA Replication GAGTCCTGTCATAAAATG 3’ CTCAGGACAGTATTTTAC 5’
“Gene” 5’  3’ GAGTCCTGTCATAAAATG 3’ 5’ CGTGGTTAAATCT 3’ GCACCAATTTAGA “Template Strand” 3’  5’ CTCAGGACAGTATTTTAC 5’ Let’s model DNA Replication!

14 What’s next? After DNA Replication, there is enough DNA make 2 new cells… and then again, and again until the organism stops performing cell division (i.e., never, really). Once a new cell is made, it can begin to use the DNA to create phenotypes. We call this next part Gene Expression, or the production of a phenotype given information from the genotype (“gene” = segments of DNA) and it can be divided into 2 steps: Transcription and Translation.

15 HAPPY FRIDAY 3/17 Take out homework for stamps Butterfly Stamps “Pedigree Analysis” Packet Meiosis Review New Stamp DNA Structure Coloring Sheet Reading Guide X 2 While I am stamping your work, please complete the DNA Replication Processing Activity In your notebook do the following: Cut out sister chromatid, DNA strand, and replication steps Decide in which order to place the steps of replication and number them Glue in sister chromatids and DNA strand, correctly indicate (with arrows) where each step takes place (if applicable)

16 Transcription Produces a RiboNucleic Acid (single) strand using a DNA template DNA is “read” from 3’  5’ (“template” strand) Transcription enzyme = RNA Polymerase Takes place in the nucleus In gene expression, mRNA is made Base pair rules: C  G G  C T  A A  U

17 Let’s Transcribe! Gene 5’ TCATGCAGAGGAGATTAA 3’ Template 3’ AGTACGTCTCCTCTAATT 5’ mRNA 5’ 3’ Gene 5’ GATCAGGGAGACTTAGCA 3’ Template 3’ CTAGTCCCTCTGAATCGT 5’

18 Translation Produces an amino acid sequence using mRNA as a template
mRNA is “read” from 5’  3’ in triplets (“codons”) Codons code for amino acids Start codon is AUG but stop codon varies Enzyme* that does this is called tRNA Takes place in cytoplasm at a ribosome After folding of polypeptide, a protein is formed!

19 The Genetic Code AUG is Met (start) ACC is Thr AGA is Arg! UAA is Stop
Examples: AUG is Met (start) ACC is Thr AGA is Arg! UAA is Stop UAG is Stop UGA is Stop

20 Alanine Threonine Glutamate Leucine Arginine Serine Stop!
Use the Genetic Code to figure out what amino acids are assembled based on mRNA strand Alanine Threonine Glutamate Leucine Arginine Serine Stop!

21 Translation Gene 5’ GATCATGCGTCTCCTCTAATT 3’ Template mRNA Amino Acids

22 Translation Gene 5’ 3’ Template 3’ CTCATACGGACAGTATTTTAC 5’ mRNA Amino Acids

23 How do you get from genotype to phenotype?
Once the amino acid sequence is complete, it folds into a 3D “glob” = a protein! Proteins do all of our cellular work, so they create phenotypes. Discuss with a neighbor: How do you get from genotype to phenotype?

24 Your Task Gene Expression Practice Worksheet
Compare to key when finished to see if you have the skills! Homework due Friday Snorks

25 Discuss with your neighbors:
Where does DNA Replication take place? Where does Transcription take place? What does Transcription produce? Where does Translation take place? What does Translation produce? The Genetic Code is used to figure out what amino acids are assembled based on the strand created from the strand

26 What is the deal with 5’ and 3’?


Download ppt "HAPPY MONDAY 3/13 Review for Inheritance Test tomorrow!"

Similar presentations


Ads by Google