Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper

Translation in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Translation protein Psssst… no nucleus!

Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

Box 1: What’s the difference between translation in prokaryotes and eukaryotes? Box 2: what’s the same between translation in prokaryotes and eukaryotes?

Translation in Eukaryotes

mRNA From gene to protein DNA transcription nucleus cytoplasm mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA a a a a a a aa ribosome protein translation

Box 3 What are 3 differences between transcription and translation?

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG

AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

Cracking the code Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT

Translation Codons blocks of 3 nucleotides coded into the sequence of amino acids

Genetic information is encoded as a sequence of nonoverlapping base triplets, or codons.

In box 4, draw a codon and its relationship to an amino acid

The code Code for ALL life! The genetic code is nearly universal, shared by organisms from the simplest bacteria to the most complex animals strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

Many amino acids have more than one codon (redundancy).

Box 5 What does it mean that the code is “redundant”?

Codons must be read in the correct reading frame for the specified polypeptide to be produced.

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small EP A

Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site

Box 6 Describe the structure and 3 sites of the ribosome.

Initiation: Initiation involves the small subunit of the ribosome binding to the 5' end of mRNA. The first tRNA enters the ribosome at the P site to initiate translation at the start codon.

Another tRNA brings the next amino acid into the A-site of the ribosome.

A peptide bond forms between the first two amino acids. The tRNA is then moved from the A-site to P-site and the ribosome moves over one codon.

The first tRNA is released from the E site.

The process continues along the mRNA until a “stop” codon is reached.

Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

Tell the person next to you the process of translation.

mRNA From gene to protein DNA transcription nucleus cytoplasm a a a a a a aa ribosome protein translation

Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

Phenotypes are determined through protein activities.

Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans

Phenylketonuria (PKU) is an autosomal recessive genetic disorder caused by a mutation in the gene for an enzyme that is necessary to metabolize the amino acid phenylalanine. Untreated PKU can lead to mental retardation, seizures, and other serious medical problems. Treatment for PKU is a PHE-restricted diet.

Cystic fibrosis Primarily people of European descent strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that transports Cl - across cell membrane defective or absent channels limit transport of Cl - (& H 2 O) across cell membrane thicker & stickier mucus coats around cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s

Effect on Lungs Chloride channel transports chloride through protein channel out of cell Osmotic effects: H 2 O follows Cl - airway Cl - H2OH2O H2OH2O mucus secreting glands bacteria & mucus build up thickened mucus hard to secrete normal lungs cystic fibrosis cells lining lungs Cl - channel

Box 7 How does protein affect phenotype?