FL #24 tRNA’s Role in Protein Synthesis DNA Double Helix Single Stranded RNA.

Slides:

Advertisements

Similar presentations

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Advertisements

RNA & Protein Synthesis

RNA and Protein Synthesis

10-2: RNA and 10-3: Protein Synthesis

DNA: Transcription & Translation How do we go from DNA to PROTEIN?

DNA translations/ protein synthesis

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Q2 WK8 D3 & 4. How does DNA’s message travel OUT of the nucleus and INTO THE CELL, where the message gets expressed as a protein??? This is known as…

Transcription and Translation

Translation: RNA to Protein Objectives Trace the path of protein synthesis.

Protein Synthesis Using RNA to make proteins. Going from DNA to Proteins Let’s review what we’ve done so far: We take our DNA and convert it into RNA.

Protein Synthesis 12-3.

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

The Genetic Code.

DNA, RNA and Protein Synthesis. In eukaryotes, genetic information is stored in which organelle? nucleus.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (__________) codes for a particular.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

RNA and Protein Synthesis

Protein Synthesis Process that makes proteins

12-3 RNA and Protein Synthesis

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

RNA AND PROTEIN SYNTHESIS

Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

DNA and Translation Gene: section of DNA that creates a specific protein Approx 25,000 human genes Proteins are used to build cells and tissue Protein.

Amino acids are coded by mRNA base sequences.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.

Making of Proteins. DNA Replication DNA molecule produces two new complementary strands. Each strand of the double helix of DNA serves as a template for.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

THE THREE TYPES OF RNA. Section 11.2 Summary – pages There are three main types of RNA that help build proteins. # 1 Messenger RNA (mRNA) brings.

The Basics of DNA. DNA Deoxyribose sugar Phosphate bonds Nitrogen bases: (A, T, C, and G) A-T and G-C complementary pairing Double stranded (helix) Found.

Genetics: RNA and Protein Synthesis

Chapter 13 From DNA to Proteins

Notes: Transcription DNA vs. RNA

RNA and Protein Synthesis

CH 12.3 RNA & Protein Synthesis.

PROTEIN SYNTHESIS CHAPTER 10 section 4

Jeopardy: DNA & Protein Synthesis

How to Make a Protein?.

12-3 RNA and Protein Synthesis

RNA and Protein Synthesis

RNA and Protein Synthesis

Amino acids are coded by mRNA base sequences.

Genetics The Central Dogma

12-3 RNA and Protein Synthesis

Protein Synthesis PowerPoint

12-3 RNA and Protein Synthesis

RNA and Protein Synthesis

RNA - TRANSLATION.

Translation Decoding the message.

GENE EXPRESSION / PROTEIN SYNTHESIS

Protein Synthesis.

Gene Expression aka Protein Synthesis.

Amino acids are coded by mRNA base sequences.

Translation 1. Translation

The Genetic Code and Translation

Protein Synthesis Chapter 10.

4a. Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA.

TRANSLATION and MUTATIONS

Amino acids are coded by mRNA base sequences.

Protein Synthesis.

Presentation transcript:

FL #24 tRNA’s Role in Protein Synthesis DNA Double Helix Single Stranded RNA

DNA & RNA Standard 4A Know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA. Translation

Different Hyperlink #2 tRNA Molecules

The Genetic Code

Translation It is the job of the ribosomes to read the mRNA so that the correct sequence and number of amino acids are assembled into the proper proteins. This decoding of mRNA message into a polypeptide chain (protein) is called translation.

Click on video camera for translation of a protein from mRNA.

The Genetic Code

The genetic code is read three nitrogenous bases at a time, so that each “word” of the coded message is three bases long. Each three-letter “word” in mRNA is known as a codon.

The tRNA anticodon is complementary to the mRNA codon. In the case of the tRNA molecule for methionine, the anticodon bases are UAC, which pair with the methionine codon, AUG, The ribosome has a second binding site for a tRNA molecule for the next codon.

Click on video camera for translation of a protein from mRNA.

1. Which type of RNA functions as the blueprint of the genetic code? A. rRNA B. tRNA C. nRNA D. mRNA

2. (DNA & RNA Standard 4a) What happens during the process of translation? A. Messenger RNA is made from DNA B. The cell uses information from mRNA to produce proteins. C. tRNA is made from mRNA D. Copies of DNA molecules are made B. The cell uses information from mRNA to produce proteins.

3. Which type of RNA codes for a single amino acid? A. rRNA B. tRNA C. nRNA D. mRNA tRNA

4. What part of the tRNA codes for that specific single amino acid? A. codon B. tRNA C. anticodon D. mRNA

5. The anticodon CAG is complementary to this codon? A. CTU B. GUC C. GCG D. ATA

6. During translation, the type of amino acid that is added to the growing polypeptide, depends on the? A. codon on mRNA B. anticodon on the mRNA C. anticodon on tRNA & codon on mRNA D. rRNA C. anticodon on tRNA &..codon on mRNA

7. Which type of RNA above contains the code for assembling amino acids in correct sequence? A B C A.B.C.D.