RNA and Protein Synthesis

Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of the nucleotide sequence from DNA into RNA. RNA contains coded information for making proteins.

The Structure of RNA There are three main differences between RNA and DNA: The sugar in RNA is ribose instead of deoxyribose. RNA is generally single-stranded. RNA contains uracil in place of thymine.

Types of RNA There are three main types of RNA: messenger RNA ribosomal RNA transfer RNA

Types of RNA Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins.

6 Messenger RNA (mRNA) Carries the information for a specific proteinCarries the information for a specific protein Made up of 500 to 1000 nucleotides longMade up of 500 to 1000 nucleotides long Sequence of 3 bases called codonSequence of 3 bases called codon AUG – methionine or start codonAUG – methionine or start codon UAA, UAG, or UGA – stop codonsUAA, UAG, or UGA – stop codons

Types of RNA Ribosomes are made up of proteins and ribosomal RNA (rRNA). Ribosome Ribosomal RNA

Types of RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome. Amino acid Transfer RNA

9 Transfer RNA (tRNA) Picks up the appropriate amino acid floating in the cytoplasmPicks up the appropriate amino acid floating in the cytoplasm Transports amino acids to the mRNATransports amino acids to the mRNA Have anticodons that are complementary to mRNA codonsHave anticodons that are complementary to mRNA codons Recognizes the appropriate codons on the mRNA and bonds to them with H-bondsRecognizes the appropriate codons on the mRNA and bonds to them with H-bonds

Protein SynthesisDNAmolecule DNA strand (template) 3 TRANSCRIPTION Codon mRNA TRANSLATION Protein Amino acid 3 5 5

11 Genetic Code  DNA contains a triplet code  Every three bases on DNA stands for ONE amino acid  Each three-letter unit on mRNA is called a codon  Each three-letter unit on tRNA is called an anticodon  Most amino acids have more than one codon!  There are 20 amino acids with a possible 64 different triplets  The code is nearly universal among living organisms

Copyright Pearson Prentice Hall The Genetic Code A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid.

13Question:  What would be the complementary RNA strand for the following DNA sequence? DNA -GCGTATG-

14

15Answer: DNA -GCGTATG-DNA -GCGTATG- RNA -CGCAUAC-RNA -CGCAUAC-

16 Messenger RNA (mRNA) methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

Steps of Protein Synthesis

18 Transcriptio n Translatio n

1. mRNA is transcribed from DNA, with the help of RNA polymerase in the cell nucleus-TRANSCRIPTION Copyright Pearson Prentice Hall

2. mRNA leaves the nucleus and enters the cytoplasm. Copyright Pearson Prentice Hall

21Ribosomes P Site A Site Large subunit Small subunitmRNA AUGCUACUUCG 3. mRNA attaches to two subunits of the ribosome.

22 P Site A Site Large subun it Small subunitmRNA AUGCUACUUCG 4. The two subunits of the ribosome bind to the start codon of an mRNA molecule

23 Transfer RNA (tRNA) amino acid attachment site UAC anticodon methionine amino acid 5. tRNA bonds with the correct amino acid according to the mRNA codon.

24 mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon 6. tRNA carries the amino acid to the ribosome. Initiation- start codon

25 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 7. Ribosome moves along the mRNA and adds more amino acids to the protein with a PEPTIDE bond.

26 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

27 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

28 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

29 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

30 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

31 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination 8. Ribosome encounters the stop codon and falls off the mRNA

32 End Product –The Protein! 9. Completed protein is released. A specific sequence of amino acids bonded together by peptide bondsA specific sequence of amino acids bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199

33 Transcription

34

The Genetic Code

Translation Lysine tRNA Phenylalanine Methionine Ribosome mRNA Start codon The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA.

Translation Protein Synthesis tRNA Ribosome mRNA Lysine Translation direction

Copyright Pearson Prentice Hall Translation The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA mRNA

Transcription RNA RNA polymerase DNA

Genes and Proteins DNA mRNA Protein Codon mRNA Alanine Arginine Leucine Amino acids within a polypeptide Single strand of DNA

RNA Editing Some DNA within a gene is not needed to produce a protein. These areas are called introns. The DNA sequences that code for proteins are called exons.

RNA Editing The introns are cut out of RNA molecules. The exons are the spliced together to form mRNA. Exon Intron DNA Pre-mRNA mRNA Cap Tail

END OF SECTION