AP Biology From Gene to Protein How Genes Work

AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

AP Biology Inheritance of metabolic diseases  suggested that genes coded for enzymes  each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Metabolism taught us about genes ABCDE disease  enzyme 1enzyme 2enzyme 3enzyme 4 metabolic pathway

AP Biology Gene to Protein Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

AP Biology March 28, 2012 Bellringer  Cut out the sentences on the worksheet Objective  Explain transcription and translation Homework  Begin reviewing for Friday’s quiz

AP Biology The Big Picture Video Try transcription and translation on the on the worksheet

AP Biology The Details Use your notes and the textbooks to put the sequencing sentences in the correct order.  Transcription Initiation, Elongation, termination  RNA Processing Modification, splicing  Translation Initiation, elongation, termination Once you think you have it in the correct order,  check your answers as I go through the lesson  Be sure to number the back of the slips once you have confirmed the correct order

AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language TranscriptionTranscription Video

AP Biology Transcription Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand same sequence as RNA  synthesis of complementary RNA strand transcription bubble  enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU build RNA 5  3

AP Biology Which gene is read? Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase & transcription factors Enhancer region  binding site far upstream of gene turns transcription on HIGH

AP Biology Transcription Factors Initiation complex  transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription  trigger the binding of RNA polymerase to DNA 1 2

AP Biology Matching bases of DNA & RNA RNA poymerase unwinds double helix and matchs RNA bases to DNA bases RNA polymerase added to the 3’ end Transcription continues until termination sequence is read U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3' 3 45

AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P A’s Post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail  longer tail, mRNA lasts longer: produces more protein 6

AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous  exons = the real gene expressed / coding DNA  introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing edit out introns  make mature mRNA transcript ~10,000 bases ~1,000 bases

AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' snRNPs  small nuclear RNA  Attaches to introns Spliceosome  several snRNPs  recognize splice site sequence cut & paste gene 78

AP Biology Gene to Protein Processed mRNA leaves the nucleus 9

AP Biology Learning Check Summarize the steps of transcription

AP Biology March 29, 2012 BellRinger  Compare contrast transcription & translation Where in the cell does it take place? Purpose? What molecule is used to synthesize the new strand? How is the process terminated? Where does the finished product go? Objectives  Explain the steps of translation  Describe various mutations Homework  Review for Chp 16 & 17 quiz

AP Biology Translation from nucleic acid language to amino acid language

AP Biology

The Structure of Proteins Proteins are made from subunits called amino acids Hundreds of thousands of different proteins made by all living things are remarkably similar in their construction  All proteins in living things are assembled from only 20 different amino acids

AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG

AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

AP Biology Transfer RNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

AP Biology Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small EP A

AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

AP Biology Building a polypeptide Video Initiation  brings together mRNA, ribosome subunits, initiator tRNA Elongation  adding amino acids based on codon sequence Termination  end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

AP Biology Protein Synthesis in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

AP Biology Protein Synthesis Prokaryotes vs Eukaryotes  While the animation is playing, jot down several ways in which protein synthesis differs in prokaryotes and eukaryotes

AP Biology Prokaryote vs. Eukaryote genes Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

AP Biology Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes  time & physical separation between processes takes eukaryote ~1 hour from DNA to protein  no RNA processing

AP Biology Can you tell the story?

AP Biology Mutations Point mutations – single base pair change Inheritable (if occurs in gametes) Mutations are changes in DNA

AP Biology Point mutation Base pair substitution  Replacement of a pair of complementary nucleotides with another nucleotide pair Some have little/no impact Silent mutation  No observable effect on the phenotype  How is this possible?

AP Biology Missense mutation Amino acid swap  Some may have little effect, others can cause disease

AP Biology Nonsense mutation Amino acid changed to stop codon Drastically alters the protein

AP Biology Mutations Frameshift mutations- involve the insertion or deletion of a base They result in an entirely different sequence of amino acids because they change the _______________ Mutations are changes in DNA

AP Biology Frameshift Mutations

AP Biology Mutagens Agents that cause mutations  Including ionizing radiation  Mutations in somatic cells are not passed on to the next generation  Some mutagens are also carcinogens