A.B. C. orf60(pOrf60) 042orf60 042 orf60(pOrf60-M5 ) orf60(pOrf60-M1) orf60(pOrf60-M4) 042orf60 042orf60(pOrf60-M5) 042 042orf60(pOrf60) 042orf60(pOrf60-M1)

Slides:

Advertisements

Similar presentations

Supplementary Figure S1 (A) Change of reporter activity levels after actinomycin D treatment. HEK293T cells were transiently transfected with the reporter.

Advertisements

Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression.

Huntington Disease An overview

The genetic code.

Center for Biological Sequence Analysis Prokaryotic gene finding Marie Skovgaard Ph.D. student

Viral Vectors May 8. Viral vectors Herpes simplex virus amplicons Adenovirus vectors Lentivirus vectors.

Huntington Disease (HD) This presentation includes: Clinical classification and features. Structure and molecular basis of the HD gene. Clinical photographs.

Protein Synthesis (making proteins)

 -GLOBIN MUTATIONS AND SICKLE CELL DISORDER (SCD) - RESTRICTION FRAGMENT LENGTH POLYMORPHISMS (RFLP)

ATG GAG GAA GAA GAT GAA GAG ATC TTA TCG TCT TCC GAT TGC GAC GAT TCC AGC GAT AGT TAC AAG GAT GAT TCT CAA GAT TCT GAA GGA GAA AAC GAT AAC CCT GAG TGC GAA.

Supplementary Fig.1: oligonucleotide primer sequences.

Gene Mutations Worksheet

Crick’s early Hypothesis Revisited. Or The Existence of a Universal Coding Frame Axel Bernal UPenn Center for Bioinformatics Jean-Louis Lassez Coastal.

Introduction to Molecular Biology. G-C and A-T pairing.

1 Essential Computing for Bioinformatics Bienvenido Vélez UPR Mayaguez Lecture 5 High-level Programming with Python Part II: Container Objects Reference:

In vitro expression of BVDV capsid protein Corpus Christi College, University of Oxford Glycobiology Institute, Department of Biochemistry KOR SHU CHAN.

Today… Genome 351, 8 April 2013, Lecture 3 The information in DNA is converted to protein through an RNA intermediate (transcription) The information in.

Figure S1. Sequence alignment of yeast and horse cyt-c (Identity~60%), green highly conserved residues. There are 40 amino acid differences in the primary.

The Cloning of Atrolysin A from Crotalus atrox By AJ Goos & Kayla Ohrt.

Reading the blueprint of life DNA sequencing. Introduction The blueprint of life is contained in the DNA in the nuclei of eukaryotic cells and simply.

GENE MUTATIONS aka point mutations. DNA sequence ↓ mRNA sequence ↓ Polypeptide Gene mutations which affect only one gene Transcription Translation © 2010.

IGEM Arsenic Bioremediation Possibly finished biobrick for ArsR by adding a RBS and terminator. Will send for sequencing today or Monday.

Nature and Action of the Gene

Biological Dynamics Group Central Dogma: DNA->RNA->Protein.

Gene Prediction in silico Nita Parekh BIRC, IIIT, Hyderabad.

More on translation. How DNA codes proteins The primary structure of each protein (the sequence of amino acids in the polypeptide chains that make up.

Undifferentiated Differentiated (4 d) Supplemental Figure S1.

Supplemental Table S1 For Site Directed Mutagenesis and cloning of constructs P9GF:5’ GAC GCT ACT TCA CTA TAG ATA GGA AGT TCA TTT C 3’ P9GR:5’ GAA ATG.

Lecture 10, CS5671 Neural Network Applications Problems Input transformation Network Architectures Assessing Performance.

Fig. S1 siControl E2 G1: 45.7% S: 26.9% G2-M: 27.4% siER  E2 G1: 70.9% S: 9.9% G2-M: 19.2% G1: 57.1% S: 12.0% G2-M: 30.9% siRNF31 E2 A B siRNF31 siControl.

PART 1 - DNA REPLICATION PART 2 - TRANSCRIPTION AND TRANSLATION.

TRANSLATION: information transfer from RNA to protein the nucleotide sequence of the mRNA strand is translated into an amino acid sequence. This is accomplished.

Today… Genome 351, 8 April 2013, Lecture 3 The information in DNA is converted to protein through an RNA intermediate (transcription) The information in.

Cloning of Atrolysin A from Crotulas atrox AJ Goos and Kayla Ohrt.

Prodigiosin Production in E. Coli Brian Hovey and Stephanie Vondrak.

Passing Genetic Notes in Class CC106 / Discussion D by John R. Finnerty.

Supplementary materials

Chemokines A family of small proteins secreted by cells to control migration of nearby cells (e.g. during tissue development or immune response) At least.

Figure S1 (Kim et al) Introduction into the Saccharomyces cerevisiae reporter strain AH109 (Trp-/Leu-/His-/Ade-) pGBKT7-hsRad21 human fetal kidney cDNA.

Dictionaries. A “Good morning” dictionary English: Good morning Spanish: Buenas días Swedish: God morgon German: Guten morgen Venda: Ndi matscheloni Afrikaans:

Suppl. Figure 1 APP23 + X Terc +/- Terc +/-, APP23 + X Terc +/- G1Terc -/-, APP23 + X G1Terc -/- G2Terc -/-, APP23 + X G2Terc -/- G3Terc -/-, APP23 + and.

RA(4kb)- Atggagtccgaaatgctgcaatcgcctcttctgggcctgggggaggaagatgaggc……………………………………………….. ……………………………………………. ……………………….,……. …tactacatctccgtgtactcggtggagaagcgtgtcagatag.

Example 1 DNA Triplet mRNA Codon tRNA anticodon A U A T A U G C G

DNA, RNA and Protein.

The response of amino acid frequencies to directional mutation pressure in mitochondrial genomes is related to the physical properties of the amino acids.

Figure S1. Construction of pAL70

Modelling Proteomes.

Supplementary information Table-S1 (Xiao)

Sequence – 5’ to 3’ Tm ˚C Genome Position HV68 TMER7 Δ mt. Forward

Supplemental Table 3. Oligonucleotides for qPCR

GENE MUTATIONS aka point mutations © 2016 Paul Billiet ODWS.

Supplementary Figure 1 – cDNA analysis reveals that three splice site alterations generate multiple RNA isoforms. (A) c.430-1G>C (IVS 6) results in 3.

Huntington Disease (HD)

DNA By: Mr. Kauffman.

Gene architecture and sequence annotation

Schematic of the PCR assay.

PROTEIN SYNTHESIS RELAY

More on translation.

Molecular engineering of photoresponsive three-dimensional DNA

Fundamentals of Protein Structure

Neandertal DNA Sequences and the Origin of Modern Humans

Structure of the 5′ Portion of the Human Plakoglobin Gene

Station 2 Protein Synethsis.

Volume 7, Issue 9, Pages (September 1997)

Shailaja Gantla, Conny T. M. Bakker, Bishram Deocharan, Narsing R

Presentation transcript:

A.B. C. orf60(pOrf60) 042orf orf60(pOrf60-M5 ) orf60(pOrf60-M1) orf60(pOrf60-M4) 042orf60 042orf60(pOrf60-M5) orf60(pOrf60) 042orf60(pOrf60-M1) 042orf60(pOrf60-M4) MW orf60 042orf60(pOrf60) 042orf60(pOrf60-M5) 042orf60(pOrf60-M1) 042orf60(pOrf60-M4) AafA FIG. S1 Figure S1. Bacterial aggregation and settling in liquid culture. DMEM-high glucose broth cultures were cultivated for 8 h, mixed and permitted to settle undisturbed at room temperature for the time indicated. OD600 of planktonic bacteria was assessed at times indicated. M1, M4 and M5 indicate the codon positions of introduced translation stop codons as described in the text. pOrf60 derivatives (pOrf60-M1, pOrf60-M4, and pOrf60-M5) were transformed in 042orf60. Aggregative properties (Panel A and B) and AafA expression (Panel C) were ascertained in the 042orf60(pOrf60) derivatives.

FIG. S2 A. B. C. D GGTGCAGCACCTATTTAAAAATCTACATT GTGTCA TTATTCTATCCTTCCGATA TCTTATCAT GTTATAAATTCCAGAAAAGAGAACATTGTATTGGGGGGATTG ATG AAG GCT GGA AAG AAT TTT CAT TCC TTG TCG AAA CAA GCA GCT TCT GCA GAG AAG AAT ATG GAT CTT GCA CTT GCT TTT GAG CTC TGG AAA CTG GCC TCT TTA TTC TGT AAG AAA ATA GAG AAT ATA GAG TGG TGC ATG AAT AGA GCA ATG TTT TGC GAG GCT TAT ATA AGC AGA AAT CAG GAC GGT TAG Relative Gene Expression 042 orf60 orf60 (pOrf60) orf60(BAD30) orf60(pOrf60-2) pAA2(-) Relative Gene Expression 042 orf60 orf60 (pOrf60) orf60(BAD30) orf60(pOrf60-2) pAA2(-) pBAD30 pOrf60 pOrf60-2 araC P BAD Amp(r) F1_origin rrnBT1T2 p15A_origin orf60 Amp(r) F1_origin rrnBT1T2 P orf60 p15A_origin araC P BAD orf60 Amp(r) F1_origin rrnBT1T2 P orf60 p15A_origin *** Figure S2. The araC gene and PBAD promoter were removed from the cloning vector by reverse PCR of pOrf60 plasmid to generate pOrf60-2 (Panel A). The promoter for orf60 was predicted by using Bprom algorithm, with predicted -35 and -10 sites indicated in panel B. RNA transcripts for orf60 (Panel C) and aggR (Panel D) were quantitated by qRT-PCR.

042orf60(pOrf60) orf60 Optical Density (600 nm) Relative Gene Expression orf60 orf60(pOrf60) orf60(pOrf60-2) orf60(pOrf60-3) pAA(-) orf60 orf60(pOrf60) orf60(pOrf60-2) orf60(pOrf60-3) pAA(-) orf60 orf60(pOrf60) orf60(pOrf60-2) orf60(pOrf60-3) pAA(-) Time (h) A B C D FIG. S3 *** Figure S3. Growth of 042, 042orf60, and 042orf60(pOrf60) strains was determined in DMEM medium (Panel A). To assess complementation of orf60 in a lower copy number vector, orf60 including its own promoter was cloned in the low copy plasmid pACYC177 to generate pOrf orf60 was transformed with pOrf60-3 and transcriptional levels of orf60 (Panel B), aggR (Panel C) and aap (Panel D) were quantitated by qRT-PCR.

FIG. S4 Figure S4. orf60 homologs in E. coli were aligned by using PROMALS3D algorithm. Sequences considered representative of nodes in figure S2 are indicated with magenta labels. Alpha-helix (red) and beta-strand (blue) in the secondary structure were predicted by the algorithm. Key in the interpretation of consensus sequence is indicated next; aromatic amino (Y, H, W, F); hydrophobic, h, (W, F, Y, M, L, I, V, A, C, T, H); polar residues, p (D, E, H, K, N, Q, R, S, T); tiny, t (A, G, C, S); small, s (A, G, C, S, V, N, D, T, P); bulky residues, b (E, F, I, K, L, M, Q, R, W, Y); positively charged, +(K, R, H); negatively charged, - (D, E); charged, c (D, E, K, R, H). Conserved amino acids are in bold and uppercase letters.