1. Today… Genome 351, 8 April 2013, Lecture 3 The information in DNA is converted to protein through an RNA intermediate (transcription) The information in the RNA intermediate is converted into protein (translation) DNA & RNA use a triplet code for amino acids A gene is a segment of DNA that specifies a protein Promoters: start sites of transcription

2. How does info in DNA flow to protein? The genetic material: DNA -Four subunits (bases A, C, G, T) But virtually all cellular functions are mediated by proteins -Twenty subunits (amino acids) C AT G

3. The RNA Tie Club -Proposed that a transient ribonucleic acid (RNA) intermediate is involved in the conversion of info from DNA to protein

4. The “Central Dogma” DNAProtein DNA Bases include A,C,G,T DNA is double- stranded RNA 5’5’ 3’3’ sugar- phosphate backbone deoxyribose sugar in DNA ribose sugar in RNA RNA Bases include A,C,G,U RNA is (mostly) single-stranded (G:C & A:U)

5. The “Central Dogma” -Information only flows one way -It’s universal (works the same way in prokaryotes & eukaryotes) DNAmRNA Protein transcription translation

6. Transcription: copy gene into mRNA to make a specific protein promoter mRNA terminator gene 117.3117.1 116.9 116.7 GASZ CFTRCORTBP2 position in human sequence (millions of bases) This region from chromsome 7 contains the CFTR (cystic fibrosis gene): Mendel’s units of information (genes) are particular sequences along the chromosomes.

7. Transcription: copy gene into mRNA to make a specific protein mRNA promoter gene 5’5’3’3’ 3’3’5’5’ 5’5’3’3’ 3’3’5’5’ A T G A C G C C G A G C T C G promoter

8. 5’5’3’3’ 3’3’5’5’ T A coding or sense strand (same sequence as mRNA) template strand (complementary to mRNA) mRNA A U T A C C G Transcription: copy gene into mRNA to make a specific protein

9. I. initiation II. elongation III. termination

10. Transcription in vivo gene nascent RNA transcripts DNA RNA polymerases Which way (right or left) are RNA polymerases moving? Where (right or left) is the promoter? Which strand (top or bottom) is the template?

11. Transcription Translation RNA carries the information from DNA in the nucleus to the cytoplasm DNA RNA Protein

12. The Morse Code … --- …= SOS Morse code key Letters: Numbers:

13. Translating the nucleic acid code (4 different bases) to a protein code (20 aa’s)… Possible coding systems: 1 base per amino acid 2 bases per amino acid 3 bases per amino acid How is information coded in DNA?

14. 20 different amino acids and 64 possible combinations of three bases (64 “codons”) Alanine Arginine Aspartic acid Aspargine Cysteine Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine Stop Ala Arg Asp Asn Cys GlT Gln Gly His Ile LeT Lys Met Phe Pro Ser Thr Trp Tyr Val ARDNCEQGHILKMFPSTWYV*ARDNCEQGHILKMFPSTWYV* GCA, GCC, GCG, GCT AGA, AGG, CGA, CGC, CGG, CGT AAC, AAT GAC, GAT TGC, TGT GAA, GAG CAA, CAG GGA, GGC, GGG, GGT CAC, CAT ATA, ATG, ATT TTA, TTG,CTA, CTC, CTG, CTT AAA, AAG ATG TTC, TTT CCA, CCC, CCG, CCT AGC, AGT, TCA, TCC, TCG, TCT ACA,ACC, ACG, ACT TGG TAC, TAT GTA, GTC, GTG, GTT TAA, TAG, TGA There is redundancy (more than one codon) for some amino acids, but each codon specifies only one amino acid

15. The Genetic Code Table 10.5

16. = stop Another type of genetic code table

17. MetPheThrValSerThr AU G A C UU U U U AA A A AA C C C CG 5’5’3’3’ mRNA protein The triplet code 3 bases = 1 amino acid More than 1 triplet can code for the same amino acid Translation: read the information in RNA to order the amino acids in a protein Translation: converting the nucleic acid code to protein

18. Punctuation: MetPheThrValSerThr AU G A C UU U U U AA A A AA C C C CG NH 3 + COO - 5’5’3’3’ mRNA protein start:AUG = methionine, the first amino acid in (almost) all proteins stop:UAA, UAG, and UGA. STOP Translation: converting the nucleic acid code to protein

19. Translation of the mRNA requires an RNA adaptor called transfer RNA (tRNA) Each codon has a specific tRNA with a complementary anticodon, linked to a specific amino acid.

20. anticodon tRNAs ferry amino acids to the mRNA during translation aminoacyl-tRNA synthetase UAC Met UAC Met 3’3’ 5’ AUG 3’ Recognizes AUG codon in mRNA

21. A large complex of ribosomal RNAs (rRNAs) & proteins make up a ribosome Two subunits that join during protein synthesis rRNAs Provide structural support and serve as catalysts (ribozymes) The ribosome: mediates translation 1,900 base rRNA ~33 proteins 5,080 bases of rRNA (2-3 different rRNAs ~49 proteins

22. ribosome UAC Met... ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing Translation 5’5’3’3’ mRNA …AUAUGACUUCAGUAACCAUCUAAC A…

23. ribosome UAC Met... UGA Thr... ribosome + met-tRNA locates the 1st AUG (from 5’ end) & sets the reading frame for codon-anticodon base-pairing Translation 5’5’3’3’ mRNA …AUAUGACUUCAGUAACCAUCUAAC A…

24. UAC Met the ribosome breaks the Met-tRNA bond; Met is joined to the second amino acid… the Met-tRNA is released UGA Thr... …then ribosome moves over by 1 codon in the 3’ direction ribosome 5’5’3’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

25. Met UGA Thr... and the next tRNA can bind, and the process repeats AGU... Ser 5’5’3’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

26. Met UGA Thr AGU... Ser 5’5’3’3’ …AUAUGACUUCAGUAACCAUCUAAC A… mRNA Translation

27. UAG... Met Thr Ser ValThrPhe STOP When the ribosome reaches the Stop codon… termination 5’5’3’3’ …AUAUGACUUCAGUAACCAUCUAAC A… Translation

28. Met Thr Ser ValThrPhe NH 3 + COO - The finished peptide! 5’5’3’3’ …AUAUGACUUCAGUAACCAUCUAAC A…

29. Transcription and translation occur in separate compartments in eukaryotes… Transcription Translation

30. transcription and translation take place in the same compartment …but bacteria lack a nucleus

31. Where are the 5’ and 3’ ends of the mRNA? DNA mRNA ribosome Questions A B

32. 2. Which way (to the right or to the left) are ribosomes A and B moving? 3. Toward which end (left or right) is the AUG start codon? 4. Which ribosome (A or B) has the shorter nascent polypeptide? 5. Which end of the polypeptide (amino or carboxy) has not yet been synthesized? A B 5’5’3’3’ Questions

33. Which strand on the DNA sequence is the coding (sense) strand? How can you tell? Questions

34. On the DNA sequence, circle the nucleotides that correspond to the start codon. Questions

35. How many amino acids are encoded by this gene? Questions

36. Do you expect the start and stop codons of gene 2 to be represented in the DNA sequence that is shown? Questions

37. The form of mRNA An mRNA starts out with non-coding sequence at the beginning, followed by a start codon, the coding sequence, a stop codon and more non-coding sequence The non-coding portion is often referred to as the ‘untranslated region’ or UTR. 5’5’3’3’ Non- coding Coding sequence that gets translated into protein Translation start Translation stop