Chapter 17 From Gene to Protein

Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins Proteins are the links between genotype and phenotype Gene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation

Fig. 17-1 Figure 17.1 How does a single faulty gene result in the dramatic appearance of an albino deer? How does a single faulty gene result in the dramatic appearance of an albino deer?

How was the fundamental relationship between genes and proteins discovered?

Evidence from the Study of Metabolic Defects In 1909, Archibald Garrod Genes dictate phenotypes through enzymes Symptoms of an inherited disease reflect inability to synthesize a certain enzyme Linking genes to enzymes required understanding that cells synthesize and degrade molecules in a series of steps, a metabolic pathway

Nutritional Mutants in Neurospora: Scientific Inquiry George Beadle and Edward Tatum Created mutants using bread mold that were unable to survive on minimal medium as a result of inability to synthesize certain molecules one gene–one enzyme hypothesis Each gene dictates production of a specific enzyme

EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Fig. 17-2a EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Figure 17.2 Do individual genes specify the enzymes that function in a biochemical pathway? Minimal medium

RESULTS Classes of Neurospora crassa Wild type Minimal medium (MM) Fig. 17-2b RESULTS Classes of Neurospora crassa Wild type Class I mutants Class II mutants Class III mutants Minimal medium (MM) (control) MM + ornithine Condition MM + citrulline Figure 17.2 Do individual genes specify the enzymes that function in a biochemical pathway? MM + arginine (control)

CONCLUSION Wild type Precursor Precursor Precursor Precursor Gene A Fig. 17-2c CONCLUSION Class I mutants (mutation in gene A) Class II mutants (mutation in gene B) Class III mutants (mutation in gene C) Wild type Precursor Precursor Precursor Precursor Gene A Enzyme A Enzyme A Enzyme A Enzyme A Ornithine Ornithine Ornithine Ornithine Gene B Enzyme B Enzyme B Enzyme B Enzyme B Citrulline Citrulline Citrulline Citrulline Gene C Figure 17.2 Do individual genes specify the enzymes that function in a biochemical pathway? Enzyme C Enzyme C Enzyme C Enzyme C Arginine Arginine Arginine Arginine

Basic Principles of Transcription & Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA under the direction of DNA Transcription produces messenger RNA (mRNA) Translation is the synthesis of a polypeptide, which occurs under the direction of mRNA Ribosomes are the sites of translation

In prokaryotes, mRNA produced by transcription is immediately translated without more processing In a eukaryotic cell, the nuclear envelope separates transcription from translation Eukaryotic RNA transcripts are modified through RNA processing to yield finished mRNA

A primary transcript is the initial RNA transcript from any gene The central dogma is the concept that cells are governed by a cellular chain of command: DNA RNA protein

DNA TRANSCRIPTION mRNA (a) Bacterial cell Fig. 17-3a-1 Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information (a) Bacterial cell

DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide Fig. 17-3a-2 DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information (a) Bacterial cell

Nuclear envelope DNA TRANSCRIPTION Pre-mRNA (b) Eukaryotic cell Fig. 17-3b-1 Nuclear envelope DNA TRANSCRIPTION Pre-mRNA Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information (b) Eukaryotic cell

Nuclear envelope DNA TRANSCRIPTION Pre-mRNA mRNA (b) Eukaryotic cell Fig. 17-3b-2 Nuclear envelope DNA TRANSCRIPTION Pre-mRNA RNA PROCESSING mRNA Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information (b) Eukaryotic cell

Nuclear envelope DNA TRANSCRIPTION Pre-mRNA mRNA TRANSLATION Ribosome Fig. 17-3b-3 Nuclear envelope DNA TRANSCRIPTION Pre-mRNA RNA PROCESSING mRNA Figure 17.3 Overview: the roles of transcription and translation in the flow of genetic information TRANSLATION Ribosome Polypeptide (b) Eukaryotic cell

The Genetic Code How are the instructions for assembling amino acids into proteins encoded into DNA? There are 20 amino acids, but there are only four nucleotide bases in DNA How many bases correspond to an amino acid?

Codons: Triplets of Bases The flow of information from gene to protein is based on a triplet code: a series of nonoverlapping, three-nucleotide words These triplets are the smallest units of uniform length that can code for all the amino acids

During transcription, one of the two DNA strands called the template strand provides a template for ordering the sequence of nucleotides in an RNA transcript During translation, the mRNA base triplets, called codons, are read in the 5 to 3 direction Each codon specifies the amino acid to be placed at the corresponding position along a polypeptide

Codons along an mRNA molecule are read by translation machinery in the 5 to 3 direction Each codon specifies the addition of one of 20 amino acids

Gene 2 Gene 1 Gene 3 DNA template strand mRNA Codon TRANSLATION Fig. 17-4 Gene 2 DNA molecule Gene 1 Gene 3 DNA template strand TRANSCRIPTION Figure 17.4 The triplet code mRNA Codon TRANSLATION Protein Amino acid

Cracking the Code All 64 codons were deciphered by the mid- 1960s Of the 64 triplets, 61 code for amino acids; 3 triplets are “stop” signals to end translation The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid Codons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

First mRNA base (5 end of codon) Third mRNA base (3 end of codon) Fig. 17-5 Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon) Figure 17.5 The dictionary of the genetic code

Evolution of the Genetic Code The genetic code is nearly universal, shared by the simplest bacteria to the most complex animals Genes can be transcribed and translated after being transplanted from one species to another

(a) Tobacco plant expressing a firefly gene (b) Pig expressing a Fig. 17-6 Figure 17.6 Expression of genes from different species (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language

DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

3 KINDS OF RNA RIBOSOMAL RNA (rRNA) Made in nucleolus 2 subunits (large & small) Combine with proteins to form ribosomes

3 KINDS OF RNA TRANSFER RNA (tRNA) ANTICODON sequence matches CODON on mRNA to add correct amino acids during protein synthesis http://www-math.mit.edu/~lippert/18.417/lectures/01_Intro/

3 KINDS OF RNA MESSENGER RNA (mRNA) carries code from DNA to ribosomes

Synthesis of an RNA Transcript The three stages of transcription: Initiation Elongation Termination Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

Completed RNA transcript Fig. 17-7a-4 Promoter Transcription unit 5 3 3 5 DNA Start point RNA polymerase 1 Initiation 5 3 3 5 RNA transcript Template strand of DNA Unwound DNA 2 Elongation Rewound DNA 5 3 3 3 5 Figure 17.7 The stages of transcription: initiation, elongation, and termination 5 RNA transcript 3 Termination 5 3 3 5 5 3 Completed RNA transcript

Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble Enzyme = RNA polymerase- pries the DNA strands apart and hooks together the RNA nucleotides coding strand 3 A G C A T C G T 5 A G A A G C A T T T T C T C A A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

RNA polymerases RNA polymerase 1 RNA polymerase 2 RNA polymerase 3 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes

Which gene is read? Promoter region Enhancer region binding site before beginning of gene Transcription factors mediate the binding of RNA polymerase and the initiation of transcription TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH

Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

mRNA’s require EDITING before use Message in NOT CONTINUOUS INTRONS are removed Image by Riedell

mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic RNA is about 10% of eukaryotic gene. eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

RNA splicing enzymes snRNPs Spliceosome several snRNPs exon intron snRNA 5' 3' snRNPs small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene spliceosome exon excised intron 5' 3' lariat mature mRNA

mRNA EDITING PROCESSING RNA SPLICEOSOMES ALL ENZYMES ARE PROTEINS? RIBOZYMES-RNA molecules that function as enzymes (In some organisms pre-RNA can remove its own introns)

Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons

More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Why is the wobble good? Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble”- Flexible pairing at the third base of a codon is called wobble and allows some tRNAs to bind to more than one codon Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) Protein synthesis 2 A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' A U G 3' E P A

Building a polypeptide How translation works 1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G C U A C 5' U A C G A C U A C G A C G A C 5' A 5' U A A U G C U G A U A U G C U G A A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

GDP GDP Amino end of polypeptide E 3 mRNA Ribosome ready for Fig. 17-18-4 Amino end of polypeptide E 3 mRNA Ribosome ready for next aminoacyl tRNA P site A site 5 GTP GDP E E P A P A Figure 17.18 The elongation cycle of translation GDP GTP E P A

start of a secretory pathway Protein targeting Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway

Protein Synthesis in Prokaryotes Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall

Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes SEE PROCESSING VIDEO Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

COMPLETING PROTEINS POLYRIBOSOMES (POLYSOMES) Numerous ribosomes translate same mRNA at same time 3-D folding (1’, 2’, 3’ structure) Chaparonins

POST-TRANSLATIONAL MODIFICATIONS Some amino acids modified by addition of sugars, lipids, phosphate groups, etc Enzymes can modify ends, cleave into pieces join polypeptide strands (4’ structure) Ex: Made as proinsulin then cut Final insulin hormone made of two chains connected by disulfide bridges http://www.vivo.colostate.edu/hbooks/pathphys/endocrine/pancreas/insulin.html

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Mutations Mutation- change in genetic material of a cell Point Mutations- chemical changes in just one base pair Base-pair substitutions Base-pair insertions or deletions

Base Pair Substitutions Base-pair substitution- replacement of one nucleotide and its partner, with another pair of nucleotides silent mutation no amino acid change redundancy in code missense Codes for different amino acid nonsense Codes for a stop codon Slide from Explore Biology by Kim Foglia

Point mutation leads to Sickle cell anemia What kind of mutation? Base pair substitution that caused missense mutation Slide from Explore Biology by Kim Foglia

Sickle cell anemia Slide from Explore Biology by Kim Foglia

Base Pair Insertions or Deletions Frameshift - shift in the reading frame Insertions- adding base(s) Deletions- losing base(s) Frameshift mutation- occur whenever number of nucleotides inserted or deleted are not multiples of three changes everything “downstream” More damaging at beginning of gene than at end Slide modified from: Explore Biology by Kim Foglia

Mutagens Mutagens- physical or chemical agents that interact with DNA in ways that cause mutations Ex. 1920’s x-rays discovered to cause genetic changes in fruit flies Application today: preliminary screening of chemicals to identify carcinogens

WHAT IS A “GENE”? Mendel’s factors determine phenotype T.H. Morgan- genes located on specific chromosomes Beadle and Tatum’s “one gene-one enzyme” Became “One gene-one polypeptide” - Some proteins made of more than one polypeptide chain Ex: hemoglobin has 4 polypeptide chains Now: “one gene – one polypeptide or RNA” - Not all genes code for proteins

DNA Technology Gel electrophoresis- technique that uses gel as a molecular sieve to separate nucleic acids or proteins based on their size, electrical charge, and other physical properties

How does it work? Restriction enzymes- enzymes that cut DNA molecules at a limited number of specific locations In nature protect cell from foreign DNA All copies of a particular DNA molecule always yield the same set of restriction fragments when exposed to the same restriction enzyme

http://learn.genetics.utah.edu/content/labs/gel/