Protein Synthesis Chapter 11.

Slides:

Advertisements

Similar presentations

CH 11.4 & 11.5 “DNA to Polypeptide”.

Advertisements

RNA and Protein Synthesis

RNA and Protein Synthesis

RNA and Protein Synthesis

10-2: RNA and 10-3: Protein Synthesis

RNA Transcription.

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

8.4 DNA Transcription 8.5 Translation

Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.

Transcription and Translation

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

1 PROTEIN SYNTHESIS CHAPTER 10 section 4. 2 Starting with DNA DNA ‘s code must be copied and taken to the cytoplasmDNA ‘s code must be copied and taken.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

Chapter 13: RNA and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA. ________ are coded DNA instructions that control the ___________ of proteins. Genetic ______________ can be decoded by copying part of the ___________.

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.

RNA and Protein Synthesis

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

RNA AND PROTEIN SYNTHESIS

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

DNA & Protein Synthesis. Vocabulary terms to learn: gene messenger RNA (mRNA) ribosomal RNA (rRNA) transfer RNA (tRNA) transcription RNA polymerase codon.

Structure of DNA DNA is made up of a long chain of nucleotides

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.

RNA & Transcription. Contains the genetic instructions used in the development and functioning of all organisms Found in the nucleus of cells! Made up.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

Genetics: RNA and Protein Synthesis

Notes: Transcription DNA vs. RNA

RNA and Protein Synthesis

CH 12.3 RNA & Protein Synthesis.

PROTEIN SYNTHESIS CHAPTER 10 section 4

12-3 RNA & Protein Synthesis

How to Make a Protein?.

Protein Synthesis.

Protein Synthesis Chapter 10.

Transcription and Translation

RNA Ribonucleic Acid.

Chp: 12 Transcription & Translation

RNA and Protein Synthesis

Nucleic Acids: RNA Ribonucleic Acid: RNA

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

Protein Synthesis RNA.

Protein Synthesis RNA.

Steps of Translation.

RNA & Protein synthesis

DNA Replication Living Environment 2015.

Protein Synthesis.

Protein Synthesis.

Protein Synthesis Chapter 10.

Protein Synthesis.

12-3: RNA and Protein Synthesis (part 1)

Presentation transcript:

Protein Synthesis Chapter 11

RNA Genes are coded DNA instructions that control protein production First, DNA must be copied to RNA RNA structure: identical to DNA except: Sugar = Ribose (not deoxyribose) N base = C, G, A, and Uracil (U) (replaces thymine) Single-stranded

Types of RNA Main function RNA: to assemble amino acids into proteins Messenger RNA (mRNA): carry copies of instructions to make proteins from DNA in nucleus → cytoplasm (ribosomes) Ribosomal RNA (rRNA): help make ribosomes Transfer RNA (tRNA): transfers amino acids to ribosomes for protein assembly

Transcription Transcription: process by which portion of DNA is copied to complementary RNA sequence inside nucleus Requires RNA polymerase (an enzyme) Binds to DNA and separates strands Uses DNA strand as template to make RNA complement

The Genetic Code “Language” of mRNA instructions Read 3 letters at a time, called a codon, that specify a single amino acid 64 total possible codons → 20 amino acids Example: UCGCAG = UCG + CAG Serine + Glutamine… → Protein (polypeptide)

Translation Translation: the decoding of an mRNA sequence into amino acids on ribosomes Begins at AUG (“start” codon) Codons of mRNA match up with Anticodons of complementary tRNA Translation continues until a “stop” codon is read (UAA, UAG, UGA) Result is chain of new proteins!!

Protein Assembly Amino acids connect with peptide bonds to form proteins (“polypeptides”) Proper synthesis of proteins is essential to organism survival Proteins are enzymes – control most chemical reactions i.e.: photosynthesis, cellular respiration, etc. “By coding for proteins, DNA holds the key to life” Protein Synthesis