Arabidopsis Thaliana Gene AT5G58610

Slides:



Advertisements
Similar presentations
By Eden Maloney HC70AL Spring 2009 WRKY 59 and Agamous-Like 69 Genes.
Advertisements

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
The Trihelix Transcription Factor Family Heather Hernandez.
Cloning Promoters Kelli Henry April 27, 2009.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.
Methods for Gene Activity Analysis By Auni Hovanesian Krista Templeton.
What causes LCA2 blindness?
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
AP Biology DNA Study Guide. Chapter 16 Molecular Basis of Heredity The structure of DNA The major steps to replication The difference between replication,
DNA TO RNA Transcription is the process of creating a molecule that can carry the genetic blueprint for a particular protein coding gene from the DNA.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Review of Protein Synthesis. Fig TRANSCRIPTION TRANSLATION DNA mRNA Ribosome Polypeptide (a) Bacterial cell Nuclear envelope TRANSCRIPTION RNA PROCESSING.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
BIOINFORMATIK I UEBUNGEN Regulation of transcription.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
Genome Analysis Assaad text book slides only Lectures by F. Assaad can be downlaoded from muenchen.de/~farhah/index.htm.
Part Two and Three The Applications of Gene Cloning and DNA Analysis in Research and Biotechnology Chapter 10. Studying gene location and structure Chapter.
GROUP 2 DNA TO PROTEIN. 9.1 RICIN AND YOUR RIBOSOMES.
NAC Family Genes AT1G01720 AT1G77450
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Table A. Sequences used in making CsKASII RNAi constructs
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Emily Eder HC70AL - Spring 2005
From: Three Novel Pax6 Alleles in the Mouse Leading to the Same Small-Eye Phenotype Caused by Different Consequences at Target Promoters Invest. Ophthalmol.
Experimental Verification Department of Genetic Medicine
EL: To find out what a genome is and how gene expression is regulated
Exam #1 W 9/26 at 7-8:30pm in UTC 2.102A Review T 9/25 at 5pm in WRW 102 and in class 9/26.
Is AT2G23290 Important in Seed Development?
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
HC70AL Oral Presentation
What is AT5G03500? --Background and Structure--
At2G37120: A Gene Exploration
Relationship between Genotype and Phenotype
HC70AL Research Presentation
Pharmacogenomic variability and anaesthesia
Identification and differential expression of human collagenase-3 mRNA species derived from internal deletion, alternative splicing, and different polyadenylation.
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Genetics Lesson 3.
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
A Mutation in the Variable Repeat Region of the Aggrecan Gene (AGC1) Causes a Form of Spondyloepiphyseal Dysplasia Associated with Severe, Premature.
MAB1 encodes a mitochondrial PDC E1β.
7 WT 6 irx1-6 ixr fold increased expression 3 2 n- 1 AT1G18710
Presentation transcript:

Arabidopsis Thaliana Gene AT5G58610 Nancy Gallardo HC70AL

What Protein Does AT5G58610 Code for? PHD-Type Zinc Finger Transcription Factor Regulates gene expression 1065 amino acids

What's Around Gene AT5G58610 ? AT5G58600 5' 3' 3' 5' 3' 5' 5' 3' 3' 5' 3' 5' 5' 3' AT5G58600 AT5G8610 AT5G58620 AT5G58620 5' 3' 5' 3' 3' 5' 3' 5' 1045bp 2286bp 23703997-23708279

What is the Structure of AT5G58610 ? 3' 5' 5' 3' Exon Exon Exon Exon Exon Exon Exon Exon Exon Chromosome 5 4283 base pairs Reverse Orientation 9 Exons and 8 Introns

Expected T-DNA Insertion Salk_041367 LBb1-150bp Expected Sizes: WT= 908bp T-DNA= 696bp T-DNA Rv- 20bp 3' 5' Intron 2 Intron 1 546bp 362bp Exon 1 Fw- 20bp

What Were the Genotyping Results ? WT= 908 T-DNA=696 PCR Genotyping AT5G58610 700bp 1% agarose, 105 Volts, 04/15/2008, 1.5Hour Run

Do these results agree with the RT-PCR results?

Where is AT5G58610 Active? RT-PCR AT5G58610 1% Agarose 1 Hour Run 70 Volts 04/24/2008

Arabidopsis Thaliana Gene AT4G33280

What Protein Does My Gene Code for? B3-Domain Transcription Factor Families Regulate gene expression 3 families in Arabidopsis Thaliana 337 amino acids

What's Around Gene AT4G33280 ? 5' 3' AT4G33270 AT4G33280 AT4G33290 3' 3' 3' 5' AT4G33270 AT4G33280 AT4G33290 5' 5' 3' 3' 561bp 217bp 5' 16047358-16049359

What is the Structure of AT4G33280? 3' 5' 5' 3' UTR Exon Exon Exon Exon Exon UTR Intron Intron Intron Intron Chromosome 4 2002 Base pairs Reverse Orientation 5 Exons, 4 Introns, 2 UTRs

Expected T-DNA Insertion Salk_072801 Expected Sizes: WT= 402bp T-DNA= 292bp LBb1-150bp T-DNA Rv-20bp 5' 3' AT4G32270 260Bp 142bp Intron 4 Exon 5 Fw-23bp

What Were the Plants' Genotypes ? Expected T-DNA=292bp Expected Wild Type=402bp PCR Genotyping AT4G33280 Wild Type= 25 Homo T-DNA= 0 Hemi T-DNA= 0 1% agarose 1 Hour 05/15/2008 105 Volts

Carrying Out More Genotyping PCR Genotyping AT4G33280 1% agarose 05/29/08 1Hr. Run 105 Volts

Genotyping With Controls PCR Genotyping of Plants: 7, 17, 26, 33 1% Gel 05/30/08 1 Hr.Run 105 Volts

AT4G33280's Activity RT-PCR AT4G33280 Expected Product= 254bp 5:34-7:12 pm 1.5% Agarose 05/20/2008 105 Volts Expected Product= 254bp

Cloning the Upstream Region Colony Digestion pENTR+ Gene Vector Promoter Non-Recombinant 2580bp 262bp Recombinant 2842bp 1% Agarose, 1 Hour Run, 1% agarose, 105 Volts

Nomarski

THANKS TO: Dr. Goldberg Anhthu Bui Bekah Charney Daisy Robinton Brandon Le Tomokazu Kawashima