1. Daisy Robinton Matt Emmer Jason Chai
What Are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock-Out Mutations?
Daisy Robinton
Matt Emmer
Jason Chai

2. Isolation of DNA From Plant

3. Determining DNA Quality

4. How do we Know if There is an Insert?
Genotyping provides evidence for a T-DNA insert
Genotyping is done by PCR amplification of the DNA sequence of our gene with our gene-specific primers along with a primer for the T-DNA insert
We know of two ways to genotype
1. Multiplex Reaction
2. Separating Primers

5. How do we find the Insert via Genotyping?LB FW
agggtcttctcgatgtagatatgcggaagat RV

6. Multiplex Reaction
Wild Type
Wild Type
Heterozygous

7. Separating Primers

8. Sequencing Steps Cut mutant band from gel Sequence band
Set up sequencing reaction
Submit to sequencing center
Use Phred and Finch TV to analyze file
Determine T-DNA orientation
BLAST
Align 2 Sequences
Compare to expected results

9. The Dideoxy Sequencing Process
Direction of Read

10. Interpretation Sequencing Results
FINCH TV

11. Components of Performing a BLAST

12. The Bioinformatics Process

13. How to Determine a Mutant Phenotype?
Phenotyping Plants:
Observe phenotypical differences between wildtype and homozygous mutants
Study seeds with Microscope
Observe embryological differences by utilizing the Nomarski microscope