At2G37120: A Gene Exploration

Slides:



Advertisements
Similar presentations
T-DNA Mutagenesis T-DNA Mutagenesis. Transfer-DNA Mutagenesis: a chemical or physical treatment that creates changes in DNA sequence which can lead to.
Advertisements

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
The Trihelix Transcription Factor Family Heather Hernandez.
Pepper Mapping & Major Genes Mapping of chlorophyll retainer (cl) mutation in pepper The Pun1 gene for pungency QTL mapping for fruit size and shape.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
1.Generate mutants by mutagenesis of seeds Use a genetic background with lots of known polymorphisms compared to other genotypes. Availability of polymorphic.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Using mutants to clone genes Objectives 1. What is positional cloning? 2.What is insertional tagging? 3.How can one confirm that the gene cloned is the.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
Genes Traffic lights quiz Hold up the coloured card that matches the correct answer you see on the screen.
Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
Mutations to Aid in Gene Study By: Yvette Medina Cell Phys
Let’s see what you know! 23,000, microscope, nucleus, chromosomes, divide, DNA, proteins, code, genes __________.
Finding a gene based on phenotype Model organisms ’s of DNA markers mapped onto each chromosome – high density linkage map. 2. identify markers linked.
NAC Family Genes AT1G01720 AT1G77450
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Emily Eder HC70AL - Spring 2005
Experimental Verification Department of Genetic Medicine
Map-based cloning of interesting genes
Genetics and inheritance
Is AT2G23290 Important in Seed Development?
Genetics Definitions Definition Key Word
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
February 7, 2016 Journal: Why do you and your siblings have different traits even though you have the same parents?
HC70AL Oral Presentation
The same gene can have many versions.
Relationship between Genotype and Phenotype
What is AT5G03500? --Background and Structure--
The same gene can have many versions.
Relationship between Genotype and Phenotype
The same gene can have many versions.
The same gene can have many versions.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Rotation review Gaurav Moghe Genetics Program
HC70AL Research Presentation
Relationship between Genotype and Phenotype
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Arabidopsis Thaliana Gene AT5G58610
Draw a conclusion from this graph for both the red and blue line
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Material for Quiz 5 from Chapter 8
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Volume 14, Issue 12, Pages (June 2004)
Presentation transcript:

At2G37120: A Gene Exploration An Arabidopsis Journey Through Experimental Questioning By Jeremy Ziskind

What is the structure of AT2G37120? 112011 DNA Pool 5 123257 118631 -887 -823 -201 -180 -53 1 146 173 509 713 855 932 1212 1241 Expressed in Suspensor of Scarlet Runner Bean Chromosome 2 of Arabidopsis -932 base pairs in length -2 exons -5’ and 3’ UTRs What organisms is a potential ortholog found in? -Oryza sativa, Japanese rice Madison Insert SALK Inserts

What is the Gene’s Possible Function? Codes for S1Fa which is most likely a nuclear DNA binding protein S1Fa important for the binding specificity of a small protein that binds to DNA Protein only has 70 amino acids (Smallest DNA binding protein ever reported) Has no homology to any known DNA binding modules Conclusion: S1Fa belong to a NOVEL CLASS OF DNA BINDING PROTEINS!!!

SRB EST vs Arabidopsis Comparing AT2G37120 gene expression (protein sequence) in Arabidopsis to Scarlet Runner Bean expression EST: PCSC16872 (42125) Length = 408 Score = 39.6 bits (80), Expect(3) = 2e-09 Identities = 15/21 (71%), Positives = 15/21 (71%) Frame = +2 / -2 Query: 353 MRNVTSRPPITSSTINPGFNP 415 MRNV S PP TS TI PG NP Sbjct: 146 MRNVNSNPPTTSRTIKPGLNP 84 CONCLUSIONS: SRB EST has 71% region of amino acid homology to Arabidopsis protein sequence

Where is S1FA mRNA present in Arabidopsis and SRB? Conclusions: S1Fa is affected by lec1 because expression patterns are different in the absence of lec1 mRNA accumulation patterns in Scarlet Runner Bean 100 Kb Ladder PcL1L Control S1FA Bands Primer Dimerazation

Is there a knockout in Madison Lines? Rounds 1 and 2 Superpool 28 DNA Pool 5 Superpool 28 Control -201 -180 -53 1 146 173 509 713 855 932 1212 1241 DNA Pool #5 with a size of about 1400 base pairs Sequencing results verify that the insert is in DNA Pool #5! DNA Pool Screen

What is the genotype of Arabidopsis plants with SALK insert #118631? Negative Water Control Wild-type Allele Amplification Mutant Allele Amplification WT 9 8 7 6 5 4 3 2 1 Tubulin Conclusions: SALK plants 1-9 are homozygous for the wild-type allele and have no T-DNA insertions Extremely faint Tubulin

Further Experiments Further SALK genotyping must be performed to determine whether At2G37120 is important for seed development Phenotyping must be done on SALK #118631 plants to determine if the knockouts affect seed development or any other aspect of plant development DNA Pool #5 must be narrowed down to find the individual line with a knockout in At2G37120