From Gene to Protein Chapter 17

(think about what the functions of proteins are in living things…) What do genes code for? PROTEINS! (think about what the functions of proteins are in living things…) DNA proteins All the traits of the organism

The flow of genetic information in a cell The “Central Dogma” The flow of genetic information in a cell transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation Do any organisms violate the central dogma? replication

Protein Synthesis: From gene to protein aa a nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

RNA RNA Monomers = nucleotides Ribose sugar Nitrogen Bases uracil instead of thymine U bonds with A C bonds with G Single stranded Location: Nucleus or cytoplasm RNA

Types of RNA Ribosomal RNA (rRNA) Transfer RNA (tRNA) Major component of ribosomes Transfer RNA (tRNA) Folded upon itself Carries the amino acids to the mRNA Messenger RNA (mRNA) Sequence of nucleotides that determines the primary sequence of the polypeptide Made in the nucleus from the DNA: transcription snRNA (small-nuclear “snurps”) Forms the “spliceosomes” which are used to cut out introns from pre-mRNA siRNA (small-interfering) targets specific mRNA and prohibits it from being expressed

Transcription: DNA to mRNA Location: Nucleus RNA polymerase unzips DNA section and lays down nucleotides in 5’to 3’ direction. Leaves the nucleus through the nuclear pores to find a ribosome!

Coding strand = this is the protein needed or “sense strand” Template strand (noncoding) = this is the “anti-sense strand”

How is Transcription Started? Transcription Factors Cell signal to transcribe Bind to promoter region The “TATA Box” Other TF’s bind RNA polymerase can now bind Turns gene on or off

Modifying the Transcript… animation exons = the real gene expressed / coding DNA introns = non-coded section in-between sequence Spliceosomes cut out introns with ribozymes intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Starting to get hard to define a gene! Alternative Splicing Same piece of DNA can become different proteins! Not all the exons may make it to the final product Intron presence can determine which exons stay or go Increases efficiency and flexibility making proteins Starting to get hard to define a gene!

Final mRNA processing for Eukaryotes Need to protect mRNA moving to cytoplasm (enzymes in cytoplasm will attack mRNA!) add 5 GTP cap add poly-A tail A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s eukaryotic RNA is about 10% of eukaryotic gene.

Summing Up Transcription:

Understanding the Genetic Code Code is “almost” universal amongst all organisms (evolutionary heritage) Each CODON of mRNA = 3 nucleotides (EX: CCG, AUG) 64 different combinations possible Only 20 amino acids exist in the human body Some codons code for the same amino acids (degenerate or redundancy) Sequence of codons determines the sequence of the polypeptide (ex: Protein: AUG-CCG is NOT the same as CCG-AUG!)

CODON CHART You don’t need to memorize the codons (except for AUG) Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla protein

TRANSLATION: Reading the code from mRNA and creating a protein

Need: RIBOSOMES!!! Made of rRNA and proteins Functions: Facilitates bonding of tRNA anticodon to mRNA codon to MAKE THE PROTEIN! E P A

Transfer RNA Contains “anticodon” Anticodons bind to codons Some tRNA may bind with more than one codon (Supports redundancy) “Wobble” hypothesis: anticodon with U in third position can bind to A or G

Translation: mRNA to Protein Location: cytoplasm Initiation - start codon found (AUG) Elongation – amino acids are joined Termination – a STOP codon is reached

Can you tell the story? exon intron 5' GTP cap poly-A tail RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit 3' polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Protein Synthesis in Prokaryotes Transcription & translation are simultaneous in bacteria no mRNA editing ribosomes read mRNA as it is being transcribed

Prokaryote vs. Eukaryote Differences Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns No splicing Promoter & terminator sequence Smaller ribosomes Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns and exons “TATA” box promoter Transcription factors present Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise.