1. From Gene to Protein

2. (think about what the functions of proteins are in living things…)
What do genes code for?
PROTEINS!
(think about what the functions of proteins are in living things…)
______
proteins
_______________

3. ______________________________________
The “Central Dogma”
______________________________________
transcription
translation
DNA
______
protein
trait
To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages:
transcription and translation
Do any organisms violate the
central dogma?
replication

4. Protein Synthesis: From gene to proteinaa a
_________
_________
transcription
translation
DNA
mRNA
protein
ribosome
trait

5. RNA RNA Monomers = nucleotides ____________ Nitrogen Bases
uracil instead of thymine
________________
C bonds with G
_________________
Location: Nucleus or cytoplasm
RNA

6. Types of RNA Ribosomal RNA (rRNA) ____________________
Major component of ribosomes
____________________
Folded upon itself
Carries the amino acids to the mRNA
______________________
Sequence of nucleotides that determines the primary sequence of the polypeptide
______________________________
snRNA (small-nuclear “snurps”)
Forms the “spliceosomes” which are used to cut out introns from pre-mRNA
___________________________
targets specific mRNA and prohibits it from being expressed

7. Transcription: DNA to mRNA
Location: ____________
____________________________________________________________________________________________
Leaves the nucleus through the nuclear pores to find a ribosome!

8. How is Transcription Started?
Transcription Factors
Cell signal to transcribe
Bind to promoter region
_______________
Other TF’s bind
______________________________________
Turns gene on or off

9. Modifying the Transcript…
animation
exons = _______________
expressed / coding DNA
introns = ______________
in-between sequence
_____________________________________
intron = noncoding (inbetween) sequence
eukaryotic DNA
exon = coding (expressed) sequence

10. Starting to get hard to define a gene!
Alternative Splicing
_______________________________________
Not all the exons may make it to the final product
Intron presence can determine which exons stay or go
Increases efficiency and flexibility making proteins
Starting to get hard to define a gene!

11. Final mRNA processing for Eukaryotes
______________________________(enzymes in cytoplasm will attack mRNA!)
add ______________ A
3' poly-A tail
mRNA 5'
5' cap 3' G P
A’s
eukaryotic RNA is about 10% of eukaryotic gene.

12. Summing Up Transcription:

13. Understanding the Genetic Code
Code is “almost” universal amongst all organisms (evolutionary heritage)
Each CODON of mRNA = 3 nucleotides (EX: CCG, AUG)
64 different combinations possible
____________________________________
Some codons code for the same amino acids (degenerate or redundancy)
Sequence of codons determines the sequence of the polypeptide
(ex: Protein: AUG-CCG is NOT the same as CCG-AUG!)

14. CODON CHART You don’t need to memorize the codons (except for AUG)
Start codon
_________
methionine
Stop codons
___________
Strong evidence for a single origin in evolutionary theory.

15. mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG
DNA
codon
AUGCGUGUAAAUGCAUGCGCC
mRNA ?
______________________________
protein

16. TRANSLATION: _____________________________________________________

17. Need: RIBOSOMES!!! _________________________________
Functions: Facilitates bonding of tRNA anticodon to mRNA codon to MAKE THE PROTEIN! E P A

18. Transfer RNA Contains “anticodon” ________________________
Some tRNA may bind with more than one codon (Supports redundancy)
“_____________” hypothesis: anticodon with U in third position can bind to A or G

19. Translation: mRNA to Protein
Location: cytoplasm
Initiation - start codon found (AUG)
Elongation – amino acids are joined
_____________________________

20. Protein Synthesis in Prokaryotes
Transcription & translation are simultaneous in bacteria
__________
ribosomes read mRNA as it is being transcribed

21. Prokaryote vs. Eukaryote Differences
Prokaryotes
DNA in cytoplasm
circular chromosome
_________________
no introns
No splicing
Eukaryotes
DNA in nucleus
_______________
DNA wound on histone proteins
introns and exons
Splicing
Walter Gilbert hypothesis:
Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains.
Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise.