From Gene to Protein How Genes Work 2007-2008
What do genes code for? How does DNA code for cells & bodies? DNA how are cells and bodies made from the instructions in DNA DNA proteins cells bodies
DNA gets all the glory, but proteins do all the work! The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work!
Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
one gene : one enzyme hypothesis 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"
Beadle & Tatum Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium control Nucleic acid Choline Pyridoxine Riboflavin Arginine Minimal media supplemented only with… Thiamine Folic Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete X rays or ultraviolet light asexual spores create mutations positive control negative control mutation identified experimentals amino acid supplements
aa From gene to protein nucleus cytoplasm DNA mRNA protein trait
from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008
DNA RNA RNA ribose sugar N-bases lots of RNAs ____________________ mRNA, tRNA, rRNA, siRNA… transcription DNA RNA
Transcription Making mRNA transcribed DNA strand = ___________________ untranscribed DNA strand = ________________ same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme __________________________ coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5
RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes ______________________ transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes
Which gene is read? ________________________ binding site before beginning of gene __________________________________ binding site for RNA polymerase & transcription factors binding site far upstream of gene turns transcription on HIGH
Transcription Factors Initiation complex ___________________________________________ suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA
Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T
Eukaryotic genes have junk! Eukaryotic genes are not continuous ___________ = the real gene expressed / coding DNA ___________ = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription ______________________________ edit out introns eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
Discovery of exons/introns 1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia
Splicing must be accurate No room for mistakes! a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
we just broke a biological “rule”! Whoa! I think we just broke a biological “rule”! RNA splicing enzymes _________________ ________________ proteins several snRNPs recognize splice site sequence cut & paste gene snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”
Starting to get hard to define a gene! Alternative splicing _______________________________________ when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene!
More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________ eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P 50-250 A’s
DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait
from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008
How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?
mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT 1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine
Marshall Nirenberg 1960 | 1968 Har Khorana
The code Code for ALL life! Code is redundant _______________ strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Strong evidence for a single origin in evolutionary theory. _______________ AUG methionine UGA, UAA, UAG
How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid
DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait
Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end
tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA Loading tRNA __________________________________________ enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure _____________________________ _________________ _____________ E P A
Ribosomes ____________ (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain ____________ (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain ____________ (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A
Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'
start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting ______________________ _____________________ start of a secretory pathway
Can you tell the story?
The Transcriptional unit enhancer exons 1000+b 20-30b transcriptional unit 3' TAC ACT 5' DNA introns 5' 3' 5' 3'
Proteion Synthesis in Prokaryotes Bacterial chromosome Proteion Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall 2007-2008
Prokaryote vs. Eukaryote genes Prokaryotes _________________ _________________ _________________ Eukaryotes _________________ _________________ _________________ Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing