Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype

Central Dogma of Cell Biology DNA codes for DNA = REPLICATION DNA codes for RNA = TRANSCRIPTION RNA codes for protein = TRANSLATION

Replication vs. Transcription DNA-DNA Starts at replication origins Unwinds with Helicase DNA polymerase Proofreads Start with 1 DNA End with 2 DNA: ½ new, ½ old DNA-RNA Starts at promoter regions Does not need Helicase to unwind RNA polymerase No proofreading Start with 1 DNA End with same DNA and 1 RNA

mRNA RNA: Ribonucleic Acid rRNA

Differences between RNA and DNA Deoxyribonucleic Acid Double stranded Deoxyribose sugar Thymine (A,C,T,G) DNA polymerase “Master Copy” 1 major form* RNA Ribonucleic Acid Single stranded Ribose sugar Uracil (A,C,U,G) RNA polymerase “Working Copy” 3 major forms* * Can choose to discuss mtDNA here

Messenger RNA: mRNA Single-stranded, linear RNA Carries information from DNA to ribosomes

Ribosomal RNA: rRNA Helps form the structure of ribosomes, along with proteins Long coils of RNA

Transfer RNA: tRNA Short coils of RNA found in cytoplasm Matches amino acids to mRNA

Can you identify the 3 RNAs?

Transcription DNA  RNA Occurs in Nucleus RNA synthesis has three stages: Initiation RNA polymerase binds to promoter and unwinds helix Requires “initiation factors” Elongation RNA polymerase builds RNA complementary to the DNA strand What nucleotides are used? Termination RNA polymerase reaches terminator region & releases transcript

How do we know what to transcribe? Promoter Characteristic region of DNA that signals the start of a gene. A sequence of letters that signals “gene ahead!” “TATA box” and enhancers

Promoters

How do we know what to transcribe? Start and stop codons What are codons? Each 3 bases form a codon that codes for a particular amino acid AUG  methionine amino acid, but also START UAA, UGA, UAG  STOP

How do we know what to translate? Not all of the message is turned into protein Before the mRNA message leaves the nucleus, RNA editing & modifications occur DNA & RNA contain sequences that do not code for proteins = INTRONS INTRONS = IN (BETWEEN) RONS Sequences that code for proteins are expressed = EXONS EXONS = EX (PRESSED SEQUENCE) ONS

9.4 RNA Processing Primary transcripts contain extra nucleotides Introns vs. exons Splicing Add cap and tail for protection from nucleotide degrading enzymes tRNA processing also involves forming shape by base pairing or rRNA forming into ribosomes

Splicing

Why do introns exist? The presence of introns Allows for alternative RNA splicing Proteins often have a modular architecture Consisting of discrete structural and functional regions called domains In many cases Different exons code for the different domains in a protein Gene DNA Exon 1 Intron Exon 2 Exon 3 Transcription RNA processing Translation Domain 3 Domain 1 Domain 2 Polypeptide

mG cap and pol- A tail Added before mRNA leaves nucleus Cap directs mRNA to ribosome Protects ends from nucleases

If you were given this DNA sequence, what would be the mRNA If you were given this DNA sequence, what would be the mRNA? TCGATGTTCCGCCGTACGTCGTAACCG AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the coding strand Where would the message begin?

http://www.wisc-online.com/objects/ViewObject.aspx?ID=AP1302 http://learn.genetics.utah.edu/content/begin/dna/transcribe/ http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html