CENTRAL DOGMA OF BIOLOGY

Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype

Central Dogma of Cell Biology DNA codes for DNA = REPLICATION DNA codes for RNA = TRANSCRIPTION RNA codes for protein = TRANSLATION

Replication vs. Transcription DNA-DNA Starts at replication origins Unwinds with Helicase DNA polymerase Proofreads Start with 1 DNA End with 2 DNA: ½ new, ½ old DNA-RNA Starts at promoter regions Does not need Helicase to unwind RNA polymerase No proofreading Start with 1 DNA End with same DNA and 1 RNA

Transcription Process of converting DNA to mRNA Takes place in the nucleus 3 main steps: INITIATION  RNA pol binds to the DNA ELONGATION  nucleotide chain is built, complementary to the DNA message TERMINATION  RNA pol stops transcribing

How do we know what to transcribe? Promoter Characteristic region of DNA that signals the start of a gene. A sequence of letters that signals “gene ahead!” “TATA box” and enhancers

How do we know what to transcribe? Start and stop codons What are codons? Each 3 bases form a codon that codes for a particular amino acid AUG  methionine amino acid, but also START UAA, UGA, UAG  STOP

Transcription - Step One: RNA Polymerase unwinds and unzips the DNA double helix.

Transcription: Step Two: RNA polymerase adds on free-floating nucleotides A, G, C, U What does each bind with? Stops at STOP codon Releases RNA polymerase releases mRNA mRNA

How do we know what to translate? Before the mRNA message leaves the nucleus, RNA editing & modifications occur DNA & RNA contain sequences that do not code for proteins = INTRONS INTRONS = IN (BETWEEN) RONS Sequences that code for proteins are expressed = EXONS EXONS = EX (PRESSED SEQUENCE) ONS

RNA Editing 5. While still in the nucleus: a. INTRONS are cut out, and b. EXONS are spliced together c. before the RNA sequence is sent to the cytoplasm for translation

Transcription animation http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html Transcription animation

Transcription  Translation

Translation A. Process The mRNA leaves the nucleus  cytoplasm Message is read at the ribosome 1 Codon (3 letter message) is translated into 1 amino acid tRNA molecule has one end (anticodon) that matches the mRNA . Each anticodon specifies an amino acid. The amino acids are bonded together as peptide chains…which fold into proteins

The Genetic Code: 3 letters = 1 codon  1 amino acid

Animation of translation http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html Animation of translation

Practice with this sequence DNA: TCGATGTTCCGCCGTACGTCGTAACCG AGCTACAAGGCGGCATGCAGCATTGGC Use the bottom strand as the complement to the mRNA. What’s that mean? Hint: Look for where it starts. How do you know? Once you’ve found the “reading frame”, write in triplets mRNA  Use your genetic code wheel to write the amino acid sequence. How will you know when to stop?

Try again without help DNA: CCGTCATGTTCGCGCTACAAATGAAATGA GGCAGTACAAGCGCGATGTTTACTTTACT mRNA: Polypeptide: