Name of presentation Month 2009 SPARQ-ed PROJECT Mutations in the tumor suppressor gene p53 Pulari Thangavelu (PhD student) April Chromosome Instability Group UQ Diamantina Institute

Name of presentation Month 2009 Assignment: To find the mutation being introduced into the p53 protein, given a particular primer sequence EXAMPLE PRIMER SEQUENCE tgatgctgtccccgcacgatattgaacaa The four bases found in DNA DNA is made up of nucleotides. A nucleotide is made up of deoxyribose sugar, a nitrogenous base (A/T/G/C) and a phosphate group.

Name of presentation Month 2009 STEP 1: Obtain the p53 nucleotide sequence from PUBMED database. Go to the PUBMED database and select ‘Nucleotide’ in the dropdown menu

Name of presentation Month 2009 Type in p53 in the search box and click search. Select Homo Sapiens in the ‘Results by taxon’ section.

Name of presentation Month 2009 Select the first p53 mRNA sequence shown (Note: this is a complete coding sequence for the p53 protein), 2,451 bp linear mRNA, Accession: AB , GI:

Name of presentation Month 2009 At the very end of the page, you will see the nucleotide sequence of the p53 protein. Immediately above the sequence, there is the amino acid sequence under the subheading ‘CDS’. Click CDS to highlight the coding region in the nucleotide sequence.

Name of presentation Month 2009 Now copy the nucleotide sequence into the space below and highlight the CDS region in red:

Name of presentation Month 2009 STEP 2: Compare and find out which region your particular primer binds to in the p53 coding sequence. Using google, search for ‘nucleotide blast’ – an NCBI sequence alignment program and open the following page.

Name of presentation Month 2009 Copy and paste your primer sequence in the QUERY box and your p53 nucleotide sequence in the SUBJECT box. Click on BLAST. The colourful box shows a visual representation of your results while the exact nucleotide matches are shown below.

Name of presentation Month 2009 The query sequence (1-29 nucleotides in length) matched exactly to the subject sequence from its nucleotide sequence starting from Now go back to your nucleotide sequence and highlight in yellow, the corresponding region ( ). NOTE: There will be a mismatch of one nucleotide (which is your mutation). Also, the reverse primers will map in the 3’ to 5’ direction.

Name of presentation Month 2009 STEP 3: Find out which amino acid is being mutated and what the mutation is. Copy your CDS (coding sequence highlighted in red) from the nucleotide sequence below.

Name of presentation Month 2009 A codon is a group of three nucleotides coding for a single amino acid. Please refer to the codon table provided below to know the composition of each amino acid. As you will notice, ATG is a start codon (first codon of your sequence in red) and TGA is a stop codon (last codon of your sequence in red). CODON TABLE Amino acid Codons Compresse d Amino acidCodons Compresse d Ala/A GCT, GCC, GCA, GCG GCNLeu/L TTA, TTG, CTT, CTC, CTA, CTG YTR, CTN Arg/R CGT, CGC, CGA, CGG, AGA, AGG CGN, MGR Lys/KAAA, AAGAAR Asn/NAAT, AACAAYMet/MATG Asp/DGAT, GACGAYPhe/FTTT, TTCTTY Cys/CTGT, TGCTGYPro/P CCT, CCC, CCA, CCG CCN Gln/QCAA, CAGCARSer/S TCT, TCC, TCA, TCG, AGT, AGC TCN, AGY Glu/EGAA, GAGGARThr/T ACT, ACC, ACA, ACG ACN Gly/G GGT, GGC, GGA, GGG GGNTrp/WTGG His/HCAT, CACCAYTyr/YTAT, TACTAY Ile/I ATT, ATC, ATA ATHVal/V GTT, GTC, GTA, GTG GTN STARTATGSTOPTAA, TGA, TAG TAR, TRA

Name of presentation Month 2009 Next, split your above sequence into groups of three (i.e. into each codon) as shown below.

Name of presentation Month 2009 Now, copy below the highlighted primer region and pick out the mutation site. In this particular sequence, the codon being mutated is as follows: GAC With ‘G’ being mutated Using your codon table, identify which amino acid ‘GAC’ codes for and write it below. GAC codes for the amino acid Aspartic acid. From your primer sequence, you can notice that ‘G’ has been replaced by ‘C’. This mutation will now change the codon to encode for: CAC which codes for the amino acid Histidine. EXAMPLE PRIMER SEQUENCE tgatgctgtccccgcacgatattgaacaa

Name of presentation Month 2009 Results Thus we know that at the 48 amino acid position, the codon ‘gac’ is being mutated to ‘cac’ which means that an aspartic acid is being converted into a histidine amino acid. This can be written in notations as below: D48H

Name of presentation Month 2009 EXERCISE A protein’s secondary structures may be visualized in 3D using various softwares like DeepView. These structures are generated using different techniques, for e.g. x-ray crystallography and published in various journals. All these structures are also available in databases like RCSB protein data bank (see below). In this exercise, we shall look into the p53 protein structure and observe the mutations being introduced in this project.

Name of presentation Month 2009 I have previously downloaded the p53 homotetramer structure, PDB ID: A2HI. Open this structure using the DeepView software. We can see the various control and visualization panels below:

Name of presentation Month 2009 We can un-highlight a single p53 protein using the control panel (right).

Name of presentation Month 2009 Now, we can highlight a particular mutation, for e.g. R248G which is a change from Arginine to Glycine at the 248 th position, using the control panel. In this structure we can observe Arginine at the 248 th position. In the PCR we did yesterday, one set of primers introduced a change in this particular Arginine and changed it into a Glycine.

Name of presentation Month 2009 You can also study how this would affect various changes like DNA binding effects (if the mutation is in the DBD domain), electrostatic potentials, creation and deletion of different types of bonds, etc using this software. A pdf manual for this software is available for your perusal in your downtime. You may also find other p53 structures with other mutations in the RCSB database. Some examples are below: 1) V143A - PDB ID code 2J1W 2) R248G - PDB ID code 2AHI 3) R175H - PDB ID code 2AHI FUTURE EXERCISE