1. Modern Genetics

2. Name some foods that you eat.
How is Genetics used in everyday life?
Name some foods that you eat.
How many of them do you think are genetically altered?

3. Genetically Modified Foods
What are the Benefits?
What are the Risks?
Believe It or Not,
YOU are the generation
that will decide
how to use this technology!!!!

4. Genome
Is the complete set of genetic material in an organism- the order of the bases in the DNA
Can fit into the nucleus of a single cell because of the “packing system”

5. The Human Genome Project
Mapping the sequence of nucleotides…
ACCGTTTAACCGTATAGGACCACT…
for the entire amount of DNA in our cells
This info is then entered into a computer database
Researchers then compare the data to find genes, evolutionary links, and more

6. Recombinant DNA
Combines genes from different sources into a single DNA molecule
Why is this useful?
Organisms can be modified to produce products that benefit everyone
Examples:
Bacteria that could clean up oil spills or toxic waste sites
Vaccine production
Insulin production – Pure human form
Gene cloning
5. Genetically modified plants and animals

7. Biotechnology
The use of organisms to perform practical tasks for humans- to analyze and manipulate the genomes of organisms

8. Plasmids
A small circular DNA molecule separate from the much larger bacterial chromosome.

9. Plasmids – BIG DEAL
What can they be used for?

10. Restriction Enzymes
These are tools used to “cut” DNA in specific locations
AAAATTCCGAGACGAATTCAATACGAATTCGGGTTAAACCCCCGAATTCGGGCCTCA
How many times do you see GAATTC?
Draw a line between the G&A (in these sections)
So how many sections of DNA do you have now?

11. The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things.
**Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms.
Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

12. 1. **Transgenic animals are often used in research.
What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
2. **Transgenic plants and animals may have increased value as food sources.
What might happen to native species if transgenic animals or plants were released into the wild?

13. Nucleic Acid Probe Let’s say we want to find the sequence TAGGCT
A complimentary strand of DNA that has been radioactively labeled
Let’s say we want to find the sequence TAGGCT

14. Plants Animals Animal Cloning What is it How is it done When?
Use of plasmids from the soil to introduce new genes
To improve the characteristics of the plants
To delay ripening
Improved nutritional content
Resistance to spoilage or disease
Extract an egg cell
Sperm fertilizes the egg
Desired gene is injected into the fertilized egg
Same as plants- better quality “wool”
Or to mature in a shorter time
To make vaccines
Growth hormones
The nucleus from a single cell replaces the nucleus of an unfertilized egg from another animal- the egg develops into an animal that has the same genome as the nuclear donor
Cloning can offer the potential to mass produce an animal
Entire genomes can be cloned
“Dolly”

15. Polymerase Chain Reaction (PCR)
A method for amplifying a DNA base sequence.
How?
The newly synthesized DNA strands can serve as templates for making more DNA—amplifying the desired sequence.
When?
Can detect viral genes infected with the virus that causes AIDS

16. PCR

17. **Genetic Markers- particular stretches of DNA that are variable among individuals
Ex.) DNA fragments that include certain disease alleles have distinct genetic markers
**DNA fingerprinting- a particular banding pattern produced by your restriction fragments
- Unless you have an identical twin, it is unlikely to have the exact same fingerprint

18. Gel Electrophoresis
A method of separating large molecules (such as DNA fragments or proteins).
How?
An electric current is passed through a medium containing the mixture
Each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size.
Separation is based on these differences.

19. Gel Electrophoresis DNA plus restriction enzyme Power source
Longer fragments
Mixture of DNA fragments
Shorter fragments
Gel

23. Stem cells
-Cells with the potential to “turn into” an undifferentiated cells
-Have the potential into various types of cells

24. DNA Sequencing
Any lab technique used to find out the sequence of nucleotide bases in a DNA molecule or fragment.

25. DNA Sequencing Power source Gel Single strand of DNA Fluorescent dye
Strand broken after A
Strand broken after C
Strand broken after G
Strand broken after T
Power source
Gel
DNA Sequencing
Go to Section:

26. Gene Therapy
The process of introducing new genes into the DNA of a person's cells to correct a genetic disease or flaw

27. Making Recombinant DNA
Section 13-3
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
DNA recombination
Human Cell
Sticky ends
DNA insertion
Bacterial Cell
Plasmid
Bacterial cell containing gene for human growth hormone
Go to Section:
Bacterial chromosome

28. Cloning A body cell is taken from a donor animal.
Flowchart
Cloning
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an embryo.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.

29. Cloning of the First Mammal
A donor cell is taken from a sheep’s udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell
Egg Cell
Cloned Lamb
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
Embryo
The fused cell begins dividing normally.
The embryo develops normally into a lamb—Dolly
The embryo is placed in the uterus of a foster mother.
Foster Mother
Go to Section: