1. Interest Grabber A New Breed
Section 13-1
A New Breed
The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits?

2. Interest Grabber continued
Section 13-1
1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed.
2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.
3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.

3. Section Outline 13–1 Changing the Living World A. Selective Breeding
1. Hybridization
2. Inbreeding
B. Increasing Variation
1. Producing New Kinds of Bacteria
2. Producing New Kinds of Plants
Go to Section:

4. Concept Map Selective Breeding Section 13-1 consists of Inbreeding
Hybridization
which crosses
which crosses
Similar organisms
Dissimilar organisms
for example
for example
Organism breed A
Organism breed B
which
which
Retains desired characteristics
Combines desired characteristics

5. Interest Grabber The Smallest Scissors in the World
Section 13-2
The Smallest Scissors in the World
Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

6. Interest Grabber continued
Section 13-2
1. Copy the following series of DNA nucleotides onto a sheet of paper.
GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA
2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.
3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

7. Section Outline 13–2 Manipulating DNA
A. The Tools of Molecular Biology
1. DNA Extraction
2. Cutting DNA
3. Separating DNA
B. Using the DNA Sequence
1. Reading the Sequence
2. Cutting and Pasting
3. Making Copies

8. Recognition sequences
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence

9. Recognition sequences
Restriction Enzymes
Section 13-2
Recognition sequences
DNA sequence
Restriction enzyme EcoRI cuts the DNA into fragments.
Sticky end

10. Figure 13-6 Gel Electrophoresis
Section 13-2
Power source
DNA plus restriction enzyme
Longer fragments
Shorter fragments
Mixture of DNA fragments
Gel

11. Figure 13-7 DNA Sequencing
Section 13-2

12. Figure 13-8 PCR Section 13-2 DNA polymerase adds complementary strand
DNA heated to separate strands
DNA fragment to be copied
PCR cycles 1
DNA copies 1 2 3 4 4 8
5 etc.
16 etc.

13. Interest Grabber Sneaking In
Section 13-3
Sneaking In
You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

14. Interest Grabber continued
Section 13-3
1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory?
2. Why would a person download a virus program?
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

15. Section Outline 13–3 Cell Transformation A. Transforming Bacteria
B. Transforming Plant Cells
C. Transforming Animal Cells

16. Knockout Genes Section 13-3 Recombinant DNA Host Cell DNA Target gene
Flanking sequences match host
Host Cell DNA
Target gene
Recombinant DNA replaces target gene
Modified Host Cell DNA

17. Figure 13-9 Making Recombinant DNA
Section 13-3
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
DNA recombination
Human Cell
Sticky ends
DNA insertion
Bacterial Cell
Bacterial chromosome
Bacterial cell for containing gene for human growth hormone
Plasmid

18. Figure 13-10 Plant Cell Transformation
Section 13-3
Agrobacterium tumefaciens
Gene to be transferred
Cellular DNA
Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome
Recombinant plasmid
Plant cell colonies
Transformed bacteria introduce plasmids into plant cells
Complete plant is generated from transformed cell

19. Interest Grabber The Good With the Bad
Section 13-4
The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

20. Interest Grabber continued
Section 13-4
1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

21. Section Outline 13–4 Applications of Genetic Engineering
A. Transgenic Organisms
1. Transgenic Microorganisms
2. Transgenic Animals
3. Transgenic Plants
B. Cloning

22. Flowchart Cloning Section 13-4
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The fused cell begins dividing, becoming an embryo.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.

23. Figure 13-13 Cloning of the First Mammal
Section 13-4
A donor cell is taken from a sheep’s udder.
Donor Nucleus
These two cells are fused using an electric shock.
Fused Cell
Egg Cell
The nucleus of the egg cell is removed.
An egg cell is taken from an adult female sheep.
The fused cell begins dividing normally.
Cloned Lamb
Embryo
The embryo develops normally into a lamb—Dolly
The embryo is placed in the uterus of a foster mother.
Foster Mother

24. Click the image to play the video segment.
Gene Transfer
Click the image to play the video segment.
Video

25. Go Online Links from the authors on genetically modified foods
Interactive test
For links on recombinant DNA, go to and enter the Web Code as follows: cbn-4132.
For links on genetic engineering, go to and enter the Web Code as follows: cbn-4134.
Internet

26. Interest Grabber Answers
1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed.
Encourage students to refer only to breeds with which they are familiar.
2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.
Additional traits might include shape of ears, shape of muzzle (pointed or square), or length of legs with respect to body.
3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.
Students will likely assume that traits of the cross-breed are intermediate between those of the two parent breeds.
Section 1 Answers

27. Interest Grabber Answers
1. Copy the following series of DNA nucleotides onto a sheet of paper.
GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA
2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once.
1–2: Remind students to check their copies for accuracy before they begin the next step.
3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?
Students should find three occurrences of the sequence:
Section 2 Answers

28. Interest Grabber Answers
1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory?
A file can be downloaded from a diskette, a CD, or the Internet.
2. Why would a person download a virus program?
The computer user would not willingly download a virus but would download a program that was useful.
3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?
Possible answers: a useful protein or a strand of DNA that the cell would recognize and accept
Section 3 Answers

29. Interest Grabber Answers
1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
Students may say that a mouse with a humanlike immune system would be a good laboratory model for immune research.
2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?
Transgenic organisms might disrupt normal balances in ecosystems and could breed with natural populations, changing them.
Section 4 Answers

30. This slide is intentionally blank.
End of Custom Shows