AP Biology 2007-2008 From Gene to Protein How Genes Work.

Slides:



Advertisements
Similar presentations
From Gene to Protein How Genes Work
Advertisements

From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
AP Biology From Gene to Protein How Genes Work.
From Gene to Protein Chapter 17 - Campbell.
WARMUP Give three differences and three similarities between DNA and RNA.
DNA gets all the glory, but proteins do all the work!
Nucleic Acids Examples: Structure: RNA (ribonucleic acid)
Protein Synthesis Notes
From Gene to Protein.
Chapter 14. From Gene to Protein Biology 114.
Ch. 17:From Gene to Protein
From Gene to Protein How Genes Work
Chapter 17~ From Gene to Protein Protein Synthesis: overview One gene-one enzyme hypothesis (Beadle and Tatum) One gene-one polypeptide (protein) hypothesis.
From Gene to Protein Chapter 17 - Campbell What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
Ch. 17 Lecture Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation replication protein RNA.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work.
MCC BP Based on work by K. Foglia Chapter 17. From Gene to Protein.
AP Biology Lecture #33 Translation.
AP Biology From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?
AP Biology From Gene to Protein How Genes Work.
AP Details for Protein Synthesis 2014 From gene to protein.
AP Biology Chapter 17. From Gene to Protein.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work.
Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.
AP Biology From Gene to Protein How Genes Work SLIDE SHOW BY KIM FOGLIA (modified) All Blue edged slides are Kim’s (hyperlinks may have been.
Today… Turn in Bozeman homework Complete DNA modeling activity Lecture notes on Transcription & Translation POGIL Homework assigned: read article from.
AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work SLIDE SHOW BY KIM FOGLIA (modified) All Blue edged slides are Kim’s (hyperlinks may have been.
AP Biology From Gene to Protein How Genes Work.
From Gene to Protein proteinscellsbodies How does DNA code for cells & bodies? DNA.
D.N.A 1. The information carried by a DNA molecule is in
AP Biology Chapter 17. From Gene to Protein.
From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
from nucleic acid language to amino acid language
From Gene to Protein How Genes Work (Ch. 17).
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work.
Translation Unit 5B.4.
From Gene to Protein How Genes Work
Ch 17 - From Gene to Protein
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
Transcription Unit 5B.3.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
Chp.17 From Gene to Protein How Genes Work
From Gene to Protein How Genes Work.
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
From Gene to Protein How Genes Work
Presentation transcript:

AP Biology From Gene to Protein How Genes Work

AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

AP Biology Inheritance of metabolic diseases  suggested that genes coded for enzymes  each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? Metabolism taught us about genes ABCDE disease  enzyme 1enzyme 2enzyme 3enzyme 4 metabolic pathway

AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis

AP Biology Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium Minimal control Nucleic acid Choline PyridoxineRiboflavin Arginine Minimal media supplemented only with… Thiamine Folic acid Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete medium X rays or ultraviolet light asexual spores Beadle & Tatum create mutations positive control negative control experimentals mutation identified amino acid supplements

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language

AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

AP Biology Transcription Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand same sequence as RNA  synthesis of complementary RNA strand transcription bubble  enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU build RNA 5  3

AP Biology RNA polymerases 3 RNA polymerase enzymes  RNA polymerase 1 only transcribes rRNA genes makes ribosomes  RNA polymerase 2 transcribes genes into mRNA  RNA polymerase 3 only transcribes tRNA genes  each has a specific promoter sequence it recognizes

AP Biology Which gene is read? Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase & transcription factors Enhancer region  binding site far upstream of gene turns transcription on HIGH

AP Biology Transcription Factors Initiation complex  transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription  trigger the binding of RNA polymerase to DNA

AP Biology Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous  exons = the real gene expressed / coding DNA  introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing edit out introns  make mature mRNA transcript ~10,000 bases ~1,000 bases

AP Biology 1977 | 1993 Richard Roberts Philip Sharp CSHL MIT adenovirus common cold Discovery of exons/introns beta-thalassemia

AP Biology Splicing must be accurate No room for mistakes!  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' No, not smurfs! “snurps” snRNPs  small nuclear RNA  proteins Spliceosome  several snRNPs  recognize splice site sequence cut & paste gene Whoa! I think we just broke a biological “rule”!

AP Biology Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Starting to get hard to define a gene!

AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P A’s More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail  longer tail, mRNA lasts longer: produces more protein

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

AP Biology Translation from nucleic acid language to amino acid language

AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG

AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

AP Biology Cracking the code 1960 | 1968 Crick  determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17)  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

AP Biology 1960 | 1968 Marshall Nirenberg Har Khorana

AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

AP Biology RNA Codon Table (#2)

AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

AP Biology Transfer RNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

AP Biology Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small EP A

AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

AP Biology Building a polypeptide Initiation  brings together mRNA, ribosome subunits, initiator tRNA Elongation  adding amino acids based on codon sequence Termination  end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

AP Biology AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (gene?) transcriptional unit (gene) TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer b

AP Biology Protein Synthesis in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

AP Biology Prokaryote vs. Eukaryote genes Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

AP Biology Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes  time & physical separation between processes takes eukaryote ~1 hour from DNA to protein  no RNA processing

AP Biology Any Questions?? What color would a smurf turn if he held his breath?

AP Biology Substitute Slides for Student Print version

AP Biology Can you tell the story?

AP Biology 20-30b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer b