AP Biology Chapter 17. From Gene to Protein

AP Biology Metabolism teaches us about genes Metabolic defects  studying metabolic diseases suggested that genes specified proteins alkaptonuria (black urine from alkapton) PKU (phenylketonuria)  each disease is caused by non-functional enzyme ABCDE Genes create phenotype

AP Biology

AP Biology gene – 1 enzyme hypothesis Beadle & Tatum  Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments  X-rays break DNA  inactivate a gene wild type grows on “minimal” media  sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids  each type of mutant lacks a certain enzyme needed to produce a certain amino acid  non-functional enzyme = broken gene

AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum

AP Biology Beadle & Tatum’s Neurospora experiment

AP Biology So… What is a gene? One gene – one enzyme  but not all proteins are enzymes  but all proteins are coded by genes One gene – one protein  but many proteins are composed of several polypeptides  but each polypeptide has its own gene One gene – one polypeptide  but many genes only code for RNA One gene – one product  but many genes code for more than one product … Where does that leave us ?!

AP Biology Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 RNA gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like.

AP Biology proteinRNA The “Central Dogma” DNA transcriptiontranslation replication How do we move information from DNA to proteins? For simplicity sake, let’s go back to genes that code for proteins…

AP Biology From nucleus to cytoplasm… Where are the genes?  genes are on chromosomes in nucleus Where are proteins synthesized?  proteins made in cytoplasm by ribosomes How does the information get from nucleus to cytoplasm?  messenger RNA nucleus

AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded mRNA, rRNA, tRNA, siRNA…. RNADNA transcription

AP Biology Transcription Transcribed DNA strand = template strand  untranscribed DNA strand = coding strand Synthesis of complementary RNA strand  transcription bubble Enzyme  RNA polymerase

AP Biology Role of promoter 1. Where to start reading = starting point 2. Which strand to read = template strand 3. Direction on DNA = always reads DNA 3'  5' Transcription in Prokaryotes Initiation  RNA polymerase binds to promoter sequence on DNA

AP Biology Transcription in Prokaryotes Promoter sequences RNA polymerase molecules bound to bacterial DNA

AP Biology Transcription in Prokaryotes Elongation  RNA polymerase unwinds DNA ~20 base pairs at a time  reads DNA 3’  5’  builds RNA 5’  3’ (the energy governs the synthesis!) No proofreading 1 error/10 5 bases many copies short life not worth it!

AP Biology Transcription RNA

AP Biology Transcription in Prokaryotes Termination  RNA polymerase stops at termination sequence  mRNA leaves nucleus through pores RNA GC hairpin turn

AP Biology Transcription in Eukaryotes

AP Biology Prokaryote vs. Eukaryote genes Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence

AP Biology Transcription in Eukaryotes 3 RNA polymerase enzymes  RNA polymerase I only transcribes rRNA genes  RNA polymerase I I transcribes genes into mRNA  RNA polymerase I I I only transcribes rRNA genes  each has a specific promoter sequence it recognizes

AP Biology Transcription in Eukaryotes Initiation complex  transcription factors bind to promoter region upstream of gene proteins which bind to DNA & turn on or off transcription TATA box binding site  only then does RNA polymerase bind to DNA

AP Biology A A A A A 3' poly-A tail CH 3 mRNA 5' 5' cap 3' G PPP Post-transcriptional processing Primary transcript  eukaryotic mRNA needs work after transcription Protect mRNA  from RNase enzymes in cytoplasm add 5' cap add polyA tail Edit out introns eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA A’s

AP Biology Transcription to translation Differences between prokaryotes & eukaryotes  time & physical separation between processes  RNA processing

AP Biology Translation in Prokaryotes Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing needed

AP Biology mRNA From gene to protein DNA transcription nucleus cytoplasm mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA a a a a a a aa ribosome protein translation

AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

AP Biology Cracking the code Nirenberg & Matthaei  determined 1 st codon–amino acid match UUU coded for phenylalanine  created artificial poly(U) mRNA  added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain 1960 | 1968 phe–phe–phe–phe–phe–phe

AP Biology Marshall NirenbergHeinrich Matthaei

AP Biology Translation Codons  blocks of 3 nucleotides decoded into the sequence of amino acids

AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?

AP Biology The code For ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid Why is this a good thing? Start codon  AUG  methionine Stop codons  UGA, UAA, UAG

AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 5'3' 5' 3'5' UAC Met GCA Arg CAU Val

AP Biology protein transcription cytoplasm nucleus translation

AP Biology tRNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3' end

AP Biology Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  endergonic reaction ATP  AMP  energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome

AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small

AP Biology Ribosomes P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain E site (exit site)  empty tRNA leaves ribosome from exit site

AP Biology Building a polypeptide Initiation  brings together mRNA, ribosome subunits, proteins & initiator tRNA Elongation Termination

AP Biology Elongation: growing a polypeptide

AP Biology Termination: release polypeptide Release factor  “release protein” bonds to A site  bonds water molecule to polypeptide chain Now what happens to the polypeptide?

AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm start of a secretory pathway

AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large subunit small subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

AP Biology Put it all together…

AP Biology Any Questions??