The big picture………

Slides:



Advertisements
Similar presentations
Chapter 10 How proteins are made.
Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,
DNA Info DNA in the nucleus is safe
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.
Cell Protein Production
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.
10-2: RNA and 10-3: Protein Synthesis
 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
Protein Synthesis Mrs. Harlin.
PROTEIN SYNTHESIS.
The Central Dogma States: information flows in one direction from DNA to RNA to proteins. Includes 3 processes: RNA is the link between DNA and proteins.
Briefly describe the steps of DNA Replication.
Chapter 11 DNA and Genes. Proteins Form structures and control chemical reactions in cells. Polymers of amino acids. Coded for by specific sequences of.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
RNA Ribonucleic acid single stranded also made of nucleotides.
Transcription and Translation
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
VII RNA and Protein Synthesis
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
RNA and Protein Synthesis
RNA & Protein Synthesis.
Chapter From DNA to Protein.
8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.
RNA and Protein Synthesis
3 types:  mRNA – used in transcription  tRNA – used in translation  rRNA – makes up ribosomes Composed of nucleotides  5 carbon sugar = ribose  phosphate.
12-3 RNA and Protein Synthesis
Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.
Protein Synthesis What is protein synthesis? Is protein synthesis important? What is RNA? Where is RNA found? Is RNA similar to DNA? What is translation?
 Watch these 2 animations and try to explain what is going on.  Animation 1 Animation 1  Animation 2 Animation 2.
Genes and How They Work Chapter The Nature of Genes information flows in one direction: DNA (gene)RNAprotein TranscriptionTranslation.
DNA to Protein The processes of DNA transcription and translation.
Ribonucleic acid Single-stranded sugar phosphate backbone Nucleotides: C=G A=U mRNA: messenger rRNA: ribosomal tRNA: transfer.
12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.
Protein Synthesis. Review…  DNA:  Found in the nucleus  Double stranded  Contains the instructions for controlling the cell (including instructions.
The Central Theme of Molecular Biology is Protein Synthesis Step I: Going from DNA to RNA called Transcription Step II: Going from RNA to Protein called.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Topic 3.5 Transcription and Translation What is the function of DNA? DNA controls the cell, but how? DNA controls the cell by determining which proteins.
Transcription Turning DNA into RNA. Promoter Region Promoter sites: locations on DNA just before the gene Transcription factors (proteins) bind at promoter.
RNA and Protein Synthesis
Ribosomes and Protein Synthesis
PROTEIN SYNTHESIS.
Protein Synthesis Jan 2006.
Protein Synthesis.
Protein Synthesis.
RNA Another Nucleic Acid.
RNA and Protein Synthesis
Protein synthesis: TRANSCRIPTION & TRANSLATION
Protein Synthesis.
Protein Synthesis in Detail
Transcription and Translation
How DNA and RNA make Proteins.
Cell Protein Production
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Transcription Steps to Transcribe DNA:
RNA.
RNA - TRANSLATION.
Translation and Transcription
Protein Synthesis Jan 2006.
RNA, Protein Synthesis, Transcription, and Translation
Transcription and Translation
Protein Synthesis.
Transcription & Translation
The Production of Proteins by DNA
Presentation transcript:

The big picture………

Overview of Transcription

Transcription Helicase-Unzips a gene in DNA RNA Polymerase- Matches up bases to one side of gene A-U and C-G RNA splicing –introns are removed (stay “in”nucleus) – exons are joined together as mRNA (“exit the nucleus) mRNA detaches from the DNA mRNA moves out of the nucleus into the cytoplasm.

mRNA is made from 1 gene in DNA. The type of RNA made is called mRNA (messenger RNA) because it sends a message from DNA to the cytoplasm. tRNA (Transfer RNA) & rRNA (Ribosomal RNA) are also made during transcription to use in translation.

How does mRNA tell the cell what to do? mRNA is a message that codes for a protein Proteins are made in the cytoplasm and then work to keep the cell alive Translation (protein synthesis): Process of making a protein Proteins are made up of amino acids (small building blocks) There are 20 different types of amino acids

Transcription & Translation

Transcription & Translation

DNA Translation (Changing RNA to Proteins) There are 4 steps to summarize translation: 1.The mRNA attaches to the ribosome 2.On a ribosome (in the cytoplasm) the tRNA (Transfer RNA) carries an amino acid that matches the codon on the mRNA strand. a.So if the mRNA strand has the codon UUA then you would look on the Amino Acid Chart & you will find that UUA codes for the amino acid Leucine 3.The different amino acids from the multiple tRNAs start to bond together to make a protein 4.The ribosome continues to translate the mRNA message until a STOP codon is reached. a.The protein then detaches from the ribosome & is in the cell to use.

DNA Translation

DNA Translation

DNA Translation

DNA Translation

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2024 SlidePlayer.com Inc. All rights reserved.