What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.

Slides:

Advertisements

Similar presentations

Test-tube or keyboard? Computation in the life sciences.

Advertisements

LESSON 1: What is Genetic Research? PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

Study Guide 1.1 Answers should include different land and aquatic environments, as well as the atmosphere. the variety of life on Earth a type of living.

LESSON 3: Using Bioinformatics to Study Evolutionary Relationships PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

BIOINFORMATICS Ency Lee.

Bioinformatics What is bioinformatics? Why bioinformatics? The major molecular biology facts Brief history of bioinformatics Typical problems of bioinformatics:

Bioinformatics “Other techniques raise more questions than they answer. Bioinformatics is what answers the questions those techniques generate.” SheAvery

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.

Molecular Evidence Using DNA, RNA or Protein Sequences to Classify Organisms.

Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.

Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.

Biology Workbench Introduction. What is it used for? It is a web-browser to use bioinformatics tools to analyze and visualize nucleotide and protein sequences.

The Central Dogma of Molecular Biology (Things are not really this simple) Genetic information is stored in our DNA (~ 3 billion bp) The DNA of a.

Sequence Analysis. Today How to retrieve a DNA sequence? How to search for other related DNA sequences? How to search for its protein sequence? How to.

Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.

Lesson 10 Bioinformatics

Bioinformatics.

Development of Bioinformatics and its application on Biotechnology

Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Sequence Databases What are they and why do we need them.

KEY CONCEPT Science is a way of thinking, questioning, and gathering evidence.

A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.

Introduction to Bioinformatics CPSC 265. Interface of biology and computer science Analysis of proteins, genes and genomes using computer algorithms and.

Unit 1 – Lesson 3 (Representing Data)

20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.

Allele. Alternate form of a gene gene variant autosome.

DNA alphabet DNA is the principal constituent of the genome. It may be regarded as a complex set of instructions for creating an organism. Four different.

CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.

Construction of Substitution Matrices

ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?

Mining Biological Data. Protein Enzymatic ProteinsTransport ProteinsRegulatory Proteins Storage ProteinsHormonal ProteinsReceptor Proteins.

1.3 Scientific Thinking and Processes KEY CONCEPT Science is a way of thinking, questioning, and gathering evidence.

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.

BIOLOGICAL DATABASES. BIOLOGICAL DATA Bioinformatics is the science of Storing, Extracting, Organizing, Analyzing, and Interpreting information in biological.

Bioinformatics Curriculum Issues, goals, curriculum.

COMPUTATIONAL BIOLOGIST DR. MARTIN TOMPA Place of Employment: University of Washington Type of Work: Develops computer programs and algorithms to identify.

Integration of Bioinformatics into Inquiry Based Learning by Kathleen Gabric.

__________________________________________________________________________________________________ Fall 2015GCBA 815 __________________________________________________________________________________________________.

The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,

Evolution and the Foundations of Biology

Biotechnology and Bioinformatics: Bioinformatics Essential Idea: Bioinformatics is the use of computers to analyze sequence data in biological research.

L ESSON A IMS & O BJECTIVES Two part lab: First part will be completed in class today. (1) Use the online Bioinformatics tool ClustalW to analyze DNA sequences.

Determining Sequence Relationships

1 Finding disease genes: A challenge for Medicine, Mathematics and Computer Science Andrew Collins, Professor of Genetic Epidemiology and Bioinformatics.

BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.

What is “Bioinformatics”?

Bioinformatics Overview

Research Paper on BioInformatics

Karyotyping Cancer.

Biological Databases By: Komal Arora.

Alignment table: group 4

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

 The human genome contains approximately genes.  At any given moment, each of our cells has some combination of these genes turned on & others.

Bioinformatics and BLAST

Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.

Genome organization and Bioinformatics

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Bioinformatics Vicki & Joe.

LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D /

Do Now: Answer the following in your Science Notebook using complete sentences.

Chapter 1 Preview Section 2 Scientific Methods

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Specific Tumor Suppressor Genes

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

What is Genetic Research?

Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers study inherited traits by analyzing DNA sequences How are we similar? How are we different?

What is bioinformatics? Bioinformatics combines computer science, mathematics, and biology to create methods for capturing, storing, analyzing, visualizing, and sharing biological data. Bioinformatics makes it possible to analyze large and complex biological data and can be used to search biological databases, compare sequences, and draw molecular structures.

Bioinformatics tools help scientists organize, process and make sense of complex biological data sets Protein Bioinformatics Tools: DNA Sequencing Identify Mutations in DNA DNA RNA Bioinformatics Tools: RNA Sequencing Identify tissue specific gene expression Bioinformatics Tools: Protein 3D Structure visualization Question: What kinds of scientific questions can we answer with bioinformatics tools?

The Practices of Scientific Research Hypothesis and Prediction Gather and Analyze Data Interpretation and Evaluation The Scientist Observations of Nature DNA sequences from tumors contain genetic mutations Genetic differences contribute to the development of cancer Compare genomes from different cancers. Identify variants in genes X and Y. Studies by other scientists demonstrate that genes X and Y are involved in DNA repair, which could explain the increased cancer risk Do families with higher rates of cancer also have higher rates of DNA damage?

Basic Local Alignment Search Tool - BLAST Can be used to: – Compare 2 or more DNA sequences to each other – Compare 2 or more protein sequences to each other – Compare a single sequence to many sequences found in databases

Pairs of Sequences are Compared to Each Other Papaya: ATGGTGCCG Grape: ATGCTGCCG Papaya : ATGGTGCCG Tomato: ATGCAGCCG Grape : ATGCTGCCG Watermelon: ATGGACACG Tomato : ATGCAGCCG Watermelon: ATGGACACG Papaya: ATGGTGCCG Watermelon: ATGGACACG Grape : ATGGTGCCG Tomato: ATGGTGAAG Number of Nucleotide Differences: PapayaGrape TomatoWatermelon Papaya0123 Grape1024 Tomato2203 Watermelon3430