AP Biology From Gene to Protein How Genes Work

AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

AP Biology The “Central Dogma” (main idea) Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

AP Biology Inheritance of diseases  suggested that genes coded for enzymes  each disease (phenotype) was caused by a missing enzyme  For example: Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? How did we learn about genes? ABCDE disease  enzyme 1enzyme 2enzyme 3enzyme 4 metabolic pathway

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa protein translation ribosome trait

AP Biology Transcription from DNA language to RNA language

AP Biology Review: RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA… RNADNA transcription

AP Biology Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands Same method as DNA replication DNA strands stick together again after the RNA is made U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

AP Biology Transcription Making mRNA (messenger RNA)  Use DNA to make a complementary RNA strand transcription bubble  Copies the template strand of DNA  Enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU build RNA 5  3

AP Biology Eukaryotic genes have extra DNA! Eukaryotic genes are in small pieces  exons = the real gene expressed / coding DNA  introns = the “garbage” inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

AP Biology mRNA processing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA mRNA splicing edit out introns make mature mRNA transcript only exons (gene parts) left ~10,000 bases ~1,000 bases

AP Biology Many combinations possible Different mRNAs can be produced from same gene  different segments treated as exons Starting to get hard to define a gene!

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

AP Biology Translation from nucleic acid language to amino acid language

AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG

AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

AP Biology Cracking the code Crick  determined 3-letter (triplet) codon system Challenge Write as many 3 letter (English) words as you can in one minute! Can you make a sentence out of your words? WHYDIDTHEREDBATEATTHEFATRAT

AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome trait protein translation

AP Biology Transfer RNA structure anticodon on one end (sticks to mRNA) amino acid attached to other end How many different tRNAs are there?

AP Biology Ribosomes Help stick the tRNA anticodon to the mRNA codon Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small

AP Biology Ribosomes Met 5' 3' U U A C A G APE A site  holds tRNA carrying next amino acid to be added to chain P site  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

AP Biology Building a polypeptide Initiation (start)  brings together mRNA, ribosome subunits, initiator tRNA Elongation (grow)  adding amino acids based on codon sequence Termination (stop)  end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA large ribosomal subunit small ribosomal subunit EPA 5' 3' RNA polymerase exon intron tRNA

AP Biology 3' transcription stop transcription start introns The Gene transcriptional unit (gene) DNA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' exons