Protein Synthesis Notes Ch 17

Central Dogma DNA RNA Protein

Prokaryotic vs Eukaryotic Transcription Prokaryotic Transcription -takes place in cytoplasm -circular DNA w/no histones -no introns / no mRNA processing Eukaryotic Transcription -takes place in nucleus -DNA has histones and linear -introns and mRNA processing

Prokaryotic Transcription STEPS Initiation – RNA polymerase binds to promoter Elongation – RNA polymerase reads template 3’-5’ and builds mRNA strand 5’-3’ Termination – mRNA is released … forms hairpin loop. Transcription begins when an RNA polymerase binds to a promoter site on the 5' to 3' DNA (blueprint) strand. A small polypeptide portion of the RNA polymerase molecule called the sigma factor recognizes the promotor site sequence. A short leader sequence of about 10 DNA nucleotides separates the promoter from the actual gene sequence.

Eukaryotic Transcription Initiation – Transcription factors adhere to the TATA box in the promoter signaling RNA Polymerase II to attach. Additional transcription factors attach and the transcription initiation complex is formed. Enhancers/silencers Elongation – RNA Polymerase II unzips the DNA and pairs the template with complementary mRNA nucleotides. Termination – RNA Polymerase II reaches the polyadenylation (AAUAAA) sequence and releases the pre-mRNA. Regulatory sequences which increase the rate of transcription are called enhancers - those which decrease the rate of transcription are called silencers Enhancers can work if their position is moved to a new location (but still relatively near the gene - they won't work if they are millions of base pairs away or on a different chromosome) transcription *Gene expression is most often regulated at transcription

Eukaryotic Transcription HHMI transcription initiation complex Eukaryotic Transcription Transcription

mRNA processing mRNA Processing (takes place in the nucleus) Add 5’ cap (guanine with 3 phosphates) Add Poly A tail (repeated Adenines) Introns (non coding regions) cut out Exons (coding regions) fused together

snRNPs (small nuclear ribonucleoproteins) snRNPs- small nuclear RNA RNA and proteins Spliceosome - several snRNPs that carry out RNA splicing Spliceosome Animation

Ribozyme Ribozyme – RNA that functions as an enzyme Harvard Ribozymes Ribozyme – RNA that functions as an enzyme -splicing without proteins! How: Single stranded and forms 3-D structure Bases in RNA contain functional groups that may catalyze rxns. Forms hydrogen bonds Not all biological catalysts are proteins Thomas-Cech Ribozymes Sidney Altman Thomas Cech Yale U of Colorado

Animations http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf http://www.concord.org/~btinker/workbench_web/models/eukTranscription.swf http://vcell.ndsu.edu/animations/transcription/index.htm http://www.hhmi.org/biointeractive/dna/animations.html

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

Translation Codons 3 nucleotides decoded into the sequence of amino acids

Translation in Prokaryotes Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall 2007-2008

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

Translation in Eukaryotes 2007-2008

From gene to protein DNA mRNA protein transcription translation aa transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

Translation Codons blocks of 3 nucleotides decoded into the sequence of amino acids

Translation in Prokaryotes Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst… no nucleus! protein Cell membrane Cell wall 2007-2008

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein RNA processing

Translation in Eukaryotes 2007-2008

From gene to protein DNA mRNA protein transcription translation aa transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores ribosome proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? The wobble explains why the the synonymous codons for a given amino acid most often differ in their 3rd nucleotide base. Strong evidence for a single origin in evolutionary theory. Other amino acids are specified by more than one codon--usually differing at only the third position. The "Wobble Hypothesis,"discovered by Frances Crick, states that rules of base pairing are relaxed at the third position, so that a base can pair with more than one complementary base. Some tRNA anticodons have Inosine at the third position. Inosine can pair with U, C, or A. This means that we don't need 61 different tRNA molecules, only half as many. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 tRNA UAC Met GCA Arg amino acid CAU Val anti-codon

From gene to protein DNA mRNA protein transcription translation aa transcription translation DNA mRNA protein ribosome nucleus cytoplasm

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

tRNA – “Wobble” Inosine can pair with C, A, U allowing for less tRNA’s, More relaxed at the 3rd base position.

Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon Structure ribosomal RNA (rRNA) & proteins 2 subunits large Small E P A Assembled in the nucleus of Eukaryotes

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) Translation Animation McGraw Hill Ribosomes Uconn Translation Animation A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' G A U 3' E P A

Building a polypeptide 1 2 3 Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway

Can you tell the story? RNA polymerase DNA amino acids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNA synthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome