Nucleic Acids Examples: Structure: RNA (ribonucleic acid) single helix DNA (deoxyribonucleic acid) double helix Structure: monomers = nucleotides DNA RNA

Nucleotides 3 parts nitrogen base (C-N ring) pentose sugar (5C) ribose in RNA deoxyribose in DNA phosphate (PO4) group Nitrogen base I’m the A,T,C,G or U part! DNA & RNA are negatively charged: Don’t cross membranes. Contain DNA within nucleus Need help transporting mRNA across nuclear envelope. Also use this property in gel electrophoresis. Are nucleic acids charged molecules?

Types of nucleotides 2 types of nucleotides different nitrogen bases Purine = AG Pure silver! 2 types of nucleotides different nitrogen bases purines double ring N base adenine (A) guanine (G) pyrimidines single ring N base cytosine (C) thymine (T) uracil (U)

Dangling bases? Why is this important? Nucleic polymer Backbone sugar to PO4 bond phosphodiester bond new base added to sugar of previous base polymer grows in one direction N bases hang off the sugar-phosphate backbone Dangling bases? Why is this important?

Pairing of nucleotides Nucleotides bond between DNA strands H bonds purine :: pyrimidine A :: T 2 H bonds G :: C 3 H bonds The 2 strands are complementary. One becomes the template of the other & each can be a template to recreate the whole molecule. Matching bases? Why is this important?

H bonds? Why is this important? DNA molecule Double helix H bonds between bases join the 2 strands A :: T C :: G H bonds = biology’s weak bond • easy to unzip double helix for replication and then re-zip for storage • easy to unzip to “read” gene and then re-zip for storage H bonds? Why is this important?

Matching halves? Why is this a good system? Copying DNA Replication 2 strands of DNA helix are complementary have one, can build other have one, can rebuild the whole when cells divide, they must duplicate DNA exactly for the new “daughter” cells Why is this a good system? Matching halves? Why is this a good system?

Interesting note… Ratio of A-T::G-C affects stability of DNA molecule 2 H bonds vs. 3 H bonds biotech procedures more G-C = need higher T° to separate strands high T° organisms many G-C parasites many A-T (don’t know why) At the foundation of biology is chemistry!!

From Gene to Protein How Genes Work 2007-2008

DNA gets all the glory, but proteins do all the work! The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008

DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT 1960 | 1968 Cracking the code Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

Protein Synthesis in Prokaryotes Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall 2007-2008

Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing